DNASU Plasmid Repository • 480.965.5697 | Email

RANGAP1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RANGAP1
Gene Name:  Ran GTPase activating protein 1
Sequence             
Original Clone ID: FLH257935.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00073893

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1764nts         Open reading frame : 1 to 1764
Reference Sequence Alignment

ATGGCCTCGGAAGACATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGG
GGACAGCTGAGTTTCAAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGAT
GTGATTAAAGAGATTGAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACA
GTGGGCGTGGAAGCAGCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAG
CGCTGCCACTGGAGTGACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTG
ATCTCACTAGGGGAAGGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGC
GACAACGCATTCGGGCCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCC
TGCTTCACCCTGCAGGAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAG
ATCCTGGCTGCAGCTCTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTG
GCCCTGAAGGTCTTTGTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTG
GCAGAAGCTTTTAGGGTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATC
AACCACCCTGGCATCACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTC
ATCAACCTGAATGACAACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTG
AAGACCTTGCGGCAGGTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGT
GCAGTTGCCATTGCAGATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTG
TCATTCTGTGAAATCAAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAA
GCTGAGCTGGAGAAGCTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAG
CTTCAGGAGGTGCTGGAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGAC
GAGGACGAGGAGGAGGAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAG
GAGGAAGATGAGGAAGAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAG
CGAGGGCAGGGAGAGAAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGG
GAGCCAGCTCCCGTGCTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTT
CCCTCTCCAGAGAAGCTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAG
ACTGACACGTCTGACCCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTC
AAGGACGAAGCTACTGTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAG
GCTTTCAACTCCTCGTCCTTCAACTCCAACACCTTCCTCACCAGGCTCCTCGTGCACATG
GGTCTGCTCAAGAGTGAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATG
GCGCTGAACCACATGGTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTG
GCGTTCGTGACCAAGCCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTG
CTGCAGACGCTGTACAAGGTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1825
Start on reference sequence 62
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGTTGGCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : Mach1 T1-R
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RANGAP1
Symbol Nomenclature : RANGAP1
SYNONYM : Fug1; RANGAP; SD
Designation : ran GTPase-activating protein 1|segregation distorter homolog|segregation distortion
Full Nomenclature : Ran GTPase activating protein 1
GENEID : 5905
Locus Tag : RP4-756G23.7
GI : 109451453
GenBank Accession : CU013157
HGNC : 9854
MIM : 602362
Vega : OTTHUMG00000150940
Target GenBank: CR456557

 

Reference Sequence Alignment

  

HsCD00073893        ------------------------------------------------------------
NM_002883.3         ------------------------------------------------------------
XM_005261695.1      ATGGGGCTCCTGCGCCGCCCGCCTATCATTTGCGGCCTGTATTCGCGCGTCGCTCCCGCA
XM_005261696.1      ------------------------------------------ATGAATGATCTGGATCCC
NM_001278651.1      ------------------------------------------------------------
                                                                                

HsCD00073893        ------------------------------------------------------------
NM_002883.3         ------------------------------------------------------------
XM_005261695.1      GAGCCACCTCCCAGCAGGCCCACGCCCGCGGGGGCCCCGGGCTGGCGCCGCTGTCCCTGG
XM_005261696.1      ATAGCCATCTGTGTCCTGTTTGAGGAATGGGACCCTCAAACAGAGAACAGCCAAGATGCT
NM_001278651.1      ------------------------------------------------------------
                                                                                

HsCD00073893        ---------------------------------------------ATGGCCTCGGAAGAC
NM_002883.3         ---------------------------------------------ATGGCCTCGGAAGAC
XM_005261695.1      AATCGATTCTGCAGATCTCCAGGGGAGCCCACCAGCCTAGTCAACATGGCCTCGGAAGAC
XM_005261696.1      CAAGCAGTCTGCAGATCTCCAGGGGAGCCCACCAGCCTAGTCAACATGGCCTCGGAAGAC
NM_001278651.1      ---------------------------------------------ATGGCCTCGGAAGAC
                                                                 ***************

HsCD00073893        ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
NM_002883.3         ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
XM_005261695.1      ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
XM_005261696.1      ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
NM_001278651.1      ATTGCCAAGCTGGCAGAGACACTTGCCAAGACTCAGGTGGCCGGGGGACAGCTGAGTTTC
                    ************************************************************

HsCD00073893        AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
NM_002883.3         AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
XM_005261695.1      AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
XM_005261696.1      AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
NM_001278651.1      AAAGGCAAGAGCCTCAAACTCAACACTGCAGAAGATGCTAAAGATGTGATTAAAGAGATT
                    ************************************************************

HsCD00073893        GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
NM_002883.3         GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
XM_005261695.1      GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
XM_005261696.1      GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
NM_001278651.1      GAAGACTTTGACAGCTTGGAGGCTCTGCGTCTGGAAGGCAACACAGTGGGCGTGGAAGCA
                    ************************************************************

HsCD00073893        GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
NM_002883.3         GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
XM_005261695.1      GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
XM_005261696.1      GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
NM_001278651.1      GCCAGGGTCATCGCCAAGGCCTTAGAGAAGAAGTCGGAGTTGAAGCGCTGCCACTGGAGT
                    ************************************************************

HsCD00073893        GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
NM_002883.3         GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
XM_005261695.1      GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
XM_005261696.1      GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
NM_001278651.1      GACATGTTCACGGGAAGGCTGCGGACCGAGATCCCACCAGCCCTGATCTCACTAGGGGAA
                    ************************************************************

HsCD00073893        GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
NM_002883.3         GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
XM_005261695.1      GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
XM_005261696.1      GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
NM_001278651.1      GGACTCATCACAGCTGGGGCTCAGCTGGTGGAGCTGGACTTAAGCGACAACGCATTCGGG
                    ************************************************************

HsCD00073893        CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
NM_002883.3         CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
XM_005261695.1      CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
XM_005261696.1      CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
NM_001278651.1      CCCGACGGTGTGCAAGGCTTCGAGGCCCTGCTCAAGAGCTCAGCCTGCTTCACCCTGCAG
                    ************************************************************

HsCD00073893        GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
NM_002883.3         GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
XM_005261695.1      GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
XM_005261696.1      GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
NM_001278651.1      GAACTCAAGCTCAACAACTGTGGCATGGGCATTGGCGGCGGCAAGATCCTGGCTGCAGCT
                    ************************************************************

HsCD00073893        CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
NM_002883.3         CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
XM_005261695.1      CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
XM_005261696.1      CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
NM_001278651.1      CTGACCGAATGTCACCGGAAATCCAGTGCCCAAGGCAAGCCTCTGGCCCTGAAGGTCTTT
                    ************************************************************

HsCD00073893        GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
NM_002883.3         GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
XM_005261695.1      GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
XM_005261696.1      GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
NM_001278651.1      GTGGCTGGCAGAAACCGTCTGGAGAATGATGGCGCCACTGCCTTGGCAGAAGCTTTTAGG
                    ************************************************************

HsCD00073893        GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
NM_002883.3         GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
XM_005261695.1      GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
XM_005261696.1      GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
NM_001278651.1      GTCATCGGGACCCTGGAGGAGGTCCACATGCCACAGAATGGGATCAACCACCCTGGCATC
                    ************************************************************

HsCD00073893        ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
NM_002883.3         ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
XM_005261695.1      ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
XM_005261696.1      ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
NM_001278651.1      ACTGCCCTGGCCCAGGCTTTCGCTGTCAACCCCCTGCTGCGGGTCATCAACCTGAATGAC
                    ************************************************************

HsCD00073893        AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
NM_002883.3         AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
XM_005261695.1      AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
XM_005261696.1      AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
NM_001278651.1      AACACCTTCACTGAGAAGGGCGCCGTGGCCATGGCCGAGACCTTGAAGACCTTGCGGCAG
                    ************************************************************

HsCD00073893        GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
NM_002883.3         GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
XM_005261695.1      GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
XM_005261696.1      GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
NM_001278651.1      GTGGAGGTGATTAATTTTGGGGACTGCCTGGTGCGCTCCAAGGGTGCAGTTGCCATTGCA
                    ************************************************************

HsCD00073893        GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
NM_002883.3         GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
XM_005261695.1      GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
XM_005261696.1      GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
NM_001278651.1      GATGCCATCCGCGGCGGCCTGCCCAAGCTAAAGGAGCTGAACTTGTCATTCTGTGAAATC
                    ************************************************************

HsCD00073893        AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
NM_002883.3         AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
XM_005261695.1      AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
XM_005261696.1      AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
NM_001278651.1      AAGAGGGATGCTGCCCTGGCTGTTGCTGAGGCCATGGCAGACAAAGCTGAGCTGGAGAAG
                    ************************************************************

HsCD00073893        CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
NM_002883.3         CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
XM_005261695.1      CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
XM_005261696.1      CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
NM_001278651.1      CTGGACCTGAATGGCAACACCCTGGGAGAAGAAGGCTGTGAACAGCTTCAGGAGGTGCTG
                    ************************************************************

HsCD00073893        GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
NM_002883.3         GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
XM_005261695.1      GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
XM_005261696.1      GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
NM_001278651.1      GAGGGCTTCAACATGGCCAAGGTGCTGGCGTCCCTCAGTGATGACGAGGACGAGGAGGAG
                    ************************************************************

HsCD00073893        GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
NM_002883.3         GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
XM_005261695.1      GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
XM_005261696.1      GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
NM_001278651.1      GAGGAGGAAGGAGAAGAGGAAGAAGAGGAAGCAGAAGAAGAGGAGGAGGAAGATGAGGAA
                    ************************************************************

HsCD00073893        GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
NM_002883.3         GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
XM_005261695.1      GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
XM_005261696.1      GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
NM_001278651.1      GAGGAGGAAGAAGAGGAGGAGGAGGAGGAAGAAGAGCCTCAGCAGCGAGGGCAGGGAGAG
                    ************************************************************

HsCD00073893        AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
NM_002883.3         AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
XM_005261695.1      AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
XM_005261696.1      AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
NM_001278651.1      AAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTG
                    ************************************************************

HsCD00073893        CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
NM_002883.3         CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
XM_005261695.1      CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
XM_005261696.1      CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
NM_001278651.1      CTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAG
                    ************************************************************

HsCD00073893        CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
NM_002883.3         CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
XM_005261695.1      CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
XM_005261696.1      CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
NM_001278651.1      CTGCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGAC
                    ************************************************************

HsCD00073893        CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
NM_002883.3         CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
XM_005261695.1      CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
XM_005261696.1      CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
NM_001278651.1      CCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACT
                    ************************************************************

HsCD00073893        GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
NM_002883.3         GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
XM_005261695.1      GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
XM_005261696.1      GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
NM_001278651.1      GTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCG
                    ************************************************************

HsCD00073893        TCCTTCAACTCCAACACCTTCCTCACCAGGCTCCTCGTGCACATGGGTCTGCTCAAGAGT
NM_002883.3         TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
XM_005261695.1      TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
XM_005261696.1      TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
NM_001278651.1      TCCTTCAACTCCAACACCTTCCTCACCAGGCTGCTCGTGCACATGGGTCTGCTCAAGAGT
                    ******************************** ***************************

HsCD00073893        GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
NM_002883.3         GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
XM_005261695.1      GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
XM_005261696.1      GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
NM_001278651.1      GAAGACAAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATG
                    ************************************************************

HsCD00073893        GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
NM_002883.3         GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
XM_005261695.1      GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
XM_005261696.1      GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
NM_001278651.1      GTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAG
                    ************************************************************

HsCD00073893        CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
NM_002883.3         CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
XM_005261695.1      CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
XM_005261696.1      CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
NM_001278651.1      CCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTAC
                    ************************************************************

HsCD00073893        AAGGTCTAG
NM_002883.3         AAGGTCTAG
XM_005261695.1      AAGGTCTAG
XM_005261696.1      AAGGTCTAG
NM_001278651.1      AAGGTCTAG
                    *********

Pathways

NCI : Signaling events mediated by HDAC Class I
NCI : Signaling events mediated by HDAC Class II
NCI : Sumoylation by RanBP2 regulates transcriptional repression
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Disease
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : Host Interactions of HIV factors
Reactome : Interactions of Rev with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Rev-mediated nuclear export of HIV RNA
Reactome : Separation of Sister Chromatids

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
UniProt : P46060
HPRD : 03839

Clone

Cloning Information : 257935
HIP Master Clone ID : 194551
IMAGE ID : 100000510
Original Clone ID : FLH257935.01X

Organism


TAX_ID : 9606
Species Specific ID: 5905

Genome

Chromosome : 22
Map Location : 22q13
Ensembl : ENSG00000100401

Reagents

Labome : RANGAP1-antibody