DNASU Plasmid Repository • 480.965.5697 | Email

UBB (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBB
Gene Name:  ubiquitin B
Sequence             
Original Clone ID: FLH212815.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074284

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 690nts         Open reading frame : 1 to 690
Reference Sequence Alignment

ATGCAGATCTTCGTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGT
GACACCATCGAAAATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAG
CAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGACGGCCGTACTCTTTCTGACTACAAC
ATCCAGAAGGAGTCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTC
GTGAAGACCCTGACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAA
AATGTGAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATC
TTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAG
TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
ACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
AAGATCCAAGATAAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCAC
CTGGTCCTGCGCCTGAGGGGTGGCTGTTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 837
Start on reference sequence 148
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBB
Symbol Nomenclature : UBB
Designation : polyubiquitin B|polyubiquitin-B
Full Nomenclature : ubiquitin B
GENEID : 7314
HGNC : 12463
MIM : 191339
Vega : OTTHUMG00000058987
Target GenBank: BC000379

 

Reference Sequence Alignment

  

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         ATGCAGATCTTCGTGAAGACTCTGACTGGTAAGACCATCACCCTCGAGGTTGAGCCCAGT
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         GACACCATCGAGAATGTCAAGGCAAAGATCCAAGATAAGGAAGGCATCCCTCCTGACCAG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         CAGAGGCTGATCTTTGCTGGAAAACAGCTGGAAGATGGGCGCACCCTGTCTGACTACAAC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         ATCCAGAAAGAGTCCACCCTGCACCTGGTGCTCCGTCTCAGAGGTGGGATGCAAATCTTC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         GTGAAGACACTCACTGGCAAGACCATCACCCTTGAGGTCGAGCCCAGTGACACCATCGAG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         AACGTCAAAGCAAAGATCCAGGACAAGGAAGGCATTCCTCCTGACCAGCAGAGGTTGATC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         TTTGCCGGAAAGCAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAAGAG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         TCTACCCTGCACCTGGTGCTCCGTCTCAGAGGTGGGATGCAGATCTTCGTGAAGACCCTG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         ACTGGTAAGACCATCACCCTCGAGGTGGAGCCCAGTGACACCATCGAGAATGTCAAGGCA
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         AAGATCCAAGATAAGGAAGGCATTCCTTCTGATCAGCAGAGGTTGATCTTTGCCGGAAAA
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         CAGCTGGAAGATGGTCGTACCCTGTCTGACTACAACATCCAGAAAGAGTCCACCTTGCAC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         CTGGTACTCCGTCTCAGAGGTGGGATGCAAATCTTCGTGAAGACACTCACTGGCAAGACC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         ATCACCCTTGAGGTCGAGCCCAGTGACACTATCGAGAACGTCAAAGCAAAGATCCAAGAC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         AAGGAAGGCATTCCTCCTGACCAGCAGAGGTTGATCTTTGCCGGAAAGCAGCTGGAAGAT
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         GGGCGCACCCTGTCTGACTACAACATCCAGAAAGAGTCTACCCTGCACCTGGTGCTCCGT
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         CTCAGAGGTGGGATGCAGATCTTCGTGAAGACCCTGACTGGTAAGACCATCACTCTCGAA
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         GTGGAGCCGAGTGACACCATTGAGAATGTCAAGGCAAAGATCCAAGACAAGGAAGGCATC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         CCTCCTGACCAGCAGAGGTTGATCTTTGCCGGAAAACAGCTGGAAGATGGTCGTACCCTG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         TCTGACTACAACATCCAGAAAGAGTCCACCTTGCACCTGGTGCTCCGTCTCAGAGGTGGG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         ATGCAGATCTTCGTGAAGACCCTGACTGGTAAGACCATCACTCTCGAGGTGGAGCCGAGT
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         GACACCATTGAGAATGTCAAGGCAAAGATCCAAGACAAGGAAGGCATCCCTCCTGACCAG
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------------------
NM_001281720.1      ------------------------------------------------------------
NM_001281718.1      ------------------------------------------------------------
NM_001281719.1      ------------------------------------------------------------
NM_021009.5         CAGAGGTTGATCTTTGCTGGGAAACAGCTGGAAGATGGACGCACCCTGTCTGACTACAAC
NM_001281717.1      ------------------------------------------------------------
NM_001281716.1      ------------------------------------------------------------
NM_018955.3         ------------------------------------------------------------
                                                                                

HsCD00074284        ------------------------------------------------ATGCAGATCTTC
NM_001281720.1      ------------------------------------------------ATGCAGATCTTC
NM_001281718.1      ------------------------------------------------ATGCAGATCTTC
NM_001281719.1      ------------------------------------------------ATGCAGATCTTC
NM_021009.5         ATCCAGAAAGAGTCCACCCTGCACCTGGTGCTCCGTCTTAGAGGTGGGATGCAGATCTTC
NM_001281717.1      ------------------------------------------------ATGCAGATCTTC
NM_001281716.1      ------------------------------------------------ATGCAGATCTTC
NM_018955.3         ------------------------------------------------ATGCAGATCTTC
                                                                    ************

HsCD00074284        GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
NM_001281720.1      GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
NM_001281718.1      GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
NM_001281719.1      GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
NM_021009.5         GTGAAGACCCTGACTGGTAAGACCATCACTCTCGAAGTGGAGCCGAGTGACACCATTGAG
NM_001281717.1      GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
NM_001281716.1      GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
NM_018955.3         GTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAA
                    *****.***** ** ** *********** ** **.******** *********** **.

HsCD00074284        AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
NM_001281720.1      AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
NM_001281718.1      AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
NM_001281719.1      AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
NM_021009.5         AATGTCAAGGCAAAGATCCAAGACAAGGAAGGCATCCCTCCTGACCAGCAGAGGTTGATC
NM_001281717.1      AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
NM_001281716.1      AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
NM_018955.3         AATGTGAAGGCCAAGATCCAGGATAAGGAAGGCATTCCCCCCGACCAGCAGAGGCTCATC
                    ***** *****.********.** *********** ** ** ************ * ***

HsCD00074284        TTTGCAGGCAAGCAGCTGGAAGACGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
NM_001281720.1      TTTGCAGGCAAGCAGCTGGAAGATGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
NM_001281718.1      TTTGCAGGCAAGCAGCTGGAAGATGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
NM_001281719.1      TTTGCAGGCAAGCAGCTGGAAGATGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
NM_021009.5         TTTGCTGGGAAACAGCTGGAAGATGGACGCACCCTGTCTGACTACAACATCCAGAAAGAG
NM_001281717.1      TTTGCAGGCAAGCAGCTGGAAGATGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
NM_001281716.1      TTTGCAGGCAAGCAGCTGGAAGATGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
NM_018955.3         TTTGCAGGCAAGCAGCTGGAAGATGGCCGTACTCTTTCTGACTACAACATCCAGAAGGAG
                    *****:** **.*********** **.** ** ** ********************.***

HsCD00074284        TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
NM_001281720.1      TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
NM_001281718.1      TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
NM_001281719.1      TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
NM_021009.5         TCCACCCTGCACCTGGTGCTCCGTCTTAGAGGTGGGATGCAGATCTTCGTGAAGACCCTG
NM_001281717.1      TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
NM_001281716.1      TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
NM_018955.3         TCGACCCTGCACCTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTG
                    ** ************** ** ***** ******** ************************

HsCD00074284        ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
NM_001281720.1      ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
NM_001281718.1      ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
NM_001281719.1      ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
NM_021009.5         ACTGGTAAGACCATCACTCTCGAAGTGGAGCCGAGTGACACCATTGAGAATGTCAAGGCA
NM_001281717.1      ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
NM_001281716.1      ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
NM_018955.3         ACCGGCAAGACCATCACCCTGGAAGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCC
                    ** ** *********** ** *********** *********** **.***** *****.

HsCD00074284        AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
NM_001281720.1      AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
NM_001281718.1      AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
NM_001281719.1      AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
NM_021009.5         AAGATCCAAGACAAGGAAGGCATCCCTCCTGACCAGCAGAGGTTGATCTTTGCTGGGAAA
NM_001281717.1      AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
NM_001281716.1      AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
NM_018955.3         AAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAG
                    ********.** **.************** ************ * ********:** **.

HsCD00074284        CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
NM_001281720.1      CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
NM_001281718.1      CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
NM_001281719.1      CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
NM_021009.5         CAGCTGGAAGATGGACGCACCCTGTCTGACTACAACATCCAGAAAGAGTCCACCCTGCAC
NM_001281717.1      CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
NM_001281716.1      CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
NM_018955.3         CAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAGGAGTCGACCCTGCAC
                    **************.***** ** ********************.***** *********

HsCD00074284        CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
NM_001281720.1      CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
NM_001281718.1      CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
NM_001281719.1      CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
NM_021009.5         CTGGTGCTCCGTCTCAGAGGTGGGATGCAAATCTTCGTGAAGACCCTGACTGGTAAGACC
NM_001281717.1      CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
NM_001281716.1      CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
NM_018955.3         CTGGTCCTGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACC
                    ***** ** ***** ******** *****.******************** ** ******

HsCD00074284        ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
NM_001281720.1      ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
NM_001281718.1      ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
NM_001281719.1      ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
NM_021009.5         ATCACCCTCGAGGTGGAGCCCAGTGACACCATCGAGAATGTCAAGGCAAAGATCCAAGAT
NM_001281717.1      ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
NM_001281716.1      ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
NM_018955.3         ATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGAT
                    ***** ** **************************.***** *****.************

HsCD00074284        AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
NM_001281720.1      AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
NM_001281718.1      AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
NM_001281719.1      AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
NM_021009.5         AAGGAAGGCATCCCTCCTGATCAGCAGAGGTTGATCTTTGCTGGGAAACAGCTGGAAGAT
NM_001281717.1      AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
NM_001281716.1      AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
NM_018955.3         AAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGAT
                    **.*********** ** ** ********* * ********:** **.************

HsCD00074284        GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
NM_001281720.1      GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
NM_001281718.1      GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
NM_001281719.1      GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
NM_021009.5         GGACGCACCCTGTCTGACTACAACATCCAGAAAGAGTCCACTCTGCACTTGGTCCTGCGC
NM_001281717.1      GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
NM_001281716.1      GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
NM_018955.3         GGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGC
                    **.***** ** ************************** ** ****** ***********

HsCD00074284        CTGAGGGGTGGCTGTTAA
NM_001281720.1      CTGAGGGGTGGCTGTTAA
NM_001281718.1      CTGAGGGGTGGCTGTTAA
NM_001281719.1      CTGAGGGGTGGCTGTTAA
NM_021009.5         TTGAGGGGGGGTGTCTAA
NM_001281717.1      CTGAGGGGTGGCTGTTAA
NM_001281716.1      CTGAGGGGTGGCTGTTAA
NM_018955.3         CTGAGGGGTGGCTGTTAA
                     ******* **    ***

Pathways

Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Cyclin B
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activated NOTCH1 Transmits Signal to the Nucleus
Reactome : Activated TLR4 signalling
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Apoptosis
Reactome : Assembly Of The HIV Virion
Reactome : Assembly of the pre-replicative complex
Reactome : Association of licensing factors with the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Attenuation phase
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Budding and maturation of HIV virion
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Constitutive Signaling by NOTCH1 HD Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downregulation of ERBB4 signaling
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : EGFR downregulation
Reactome : ER-Phagosome pathway
Reactome : Endosomal Sorting Complex Required For Transport (ESCRT)
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Fanconi Anemia pathway
Reactome : G1 Phase
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Glycogen synthesis
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HSF1 activation
Reactome : HSF1-dependent transactivation
Reactome : Host Interactions of HIV factors
Reactome : IKK complex recruitment mediated by RIP1
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Ion channel transport
Reactome : Late Phase of HIV Life Cycle
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Membrane Trafficking
Reactome : Membrane binding and targetting of GAG proteins
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myoclonic epilepsy of Lafora
Reactome : NF-kB is activated and signals survival
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : NOTCH2 Activation and Transmission of Signal to the Nucleus
Reactome : NRIF signals cell death from the nucleus
Reactome : Negative regulation of FGFR signaling
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : Oncogene Induced Senescence
Reactome : Orc1 removal from chromatin
Reactome : Oxidative Stress Induced Senescence
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : PCP/CE pathway
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Receptor-ligand binding initiates the second proteolytic cleavage of Notch receptor
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by NOTCH2
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Spry regulation of FGF signaling
Reactome : Stabilization of p53
Reactome : Stimuli-sensing channels
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
Reactome : Transmembrane transport of small molecules
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
Reactome : regulation of FZD by ubiquitination
WikiPathway : Proteasome Degradation

Protein

SMART domain : UBQ : Ubiquitin homologues
UniProt : P0CG47
UniProt : Q5U5U6
HPRD : 06771

Clone

Cloning Information : 212815
HIP Master Clone ID : 31273
Original Clone ID : FLH212815.01X

Organism


TAX_ID : 9606
Species Specific ID: 7314

Genome

Chromosome : 17
Map Location : 17p12-p11.2
Ensembl : ENSG00000170315

Reagents

Labome : ubiquitin-antibody