DNASU Plasmid Repository • 480.965.5697 | Email

ACTL6 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ACTL6B
Gene Name:  actin-like 6B
Sequence             
Original Clone ID: FLH212894.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074347

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1281nts        
Open reading frame : 1 to 1281
Reference Sequence Alignment

ATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTGGTCTTTGACATTGGCTCC
TTCTCAGTCCGCGCTGGGTACGCTGGGGAGGACTGTCCCAAGGCTGACTTCCCCACCACA
GTGGGGCTGCTGGCCGCGGAGGAGGGGGGCGGGCTGGAGCTGGAGGGGGACAAAGAGAAG
AAAGGGAAGATCTTCCACATCGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAG
GTCATGTCGCCCCTCAAGAATGGCATGATCGAGGACTGGGAGTGCTTCCGAGCCATCCTG
GATCACACCTACAGCAAACACGTCAAGTCTGAGCCAAACCTGCACCCAGTGCTCATGTCC
GAGGCTCCGTGGAACACACGGGCCAAGCGGGAGAAGCTGACAGAGCTGATGTTCGAGCAG
TACAACATTCCTGCCTTCTTCTTATGCAAGACGGCTGTGCTCACCGCCTTTGCAAACGGG
CGGTCCACTGGCCTCGTGCTGGACAGTGGAGCCACCCACACCACGGCCATTCCAGTACAT
GACGGCTACGTTCTGCAGCAAGGCATCGTCAAGTCCCCTCTGGCAGGGGACTTCATCTCC
ATGCAGTGCCGGGAGCTGTTCCAGGAGATGGCCATTGACATCATCCCACCTTACATGATC
GCAGCCAAGGAGCCTGTCCGGGAGGGTGCCCCCCCAAACTGGAAGAAGAAGGAGAAGCTA
CCCCAGGTCTCCAAGTCCTGGCATAACTACATGTGTAATGAGGTGATCCAGGACTTCCAG
GCCTCCGTGCTGCAGGTCTCAGACTCCCCCTACGATGAACAGGTGGCTGCACAAATGCCC
ACAGTGCACTACGAGATGCCCAATGGCTACAATACAGACTACGGCGCCGAGCGACTCCGC
ATCCCTGAGGGCCTGTTTGATCCCTCGAACGTCAAGGGCCTGTCGGGGAACACCATGTTG
GGTGTGGGCCACGTGGTGACCACCAGCATCGGCATGTGTGACATTGATATTCGCCCGGGC
CTGTACGGGAGTGTCATTGTCACCGGCGGGAACACACTGCTGCAGGGCTTCACTGACAGG
CTCAATCGAGAGCTTTCCCAGAAGACCCCACCGAGCATGCGACTGAAACTCATTGCCAGC
AACAGCACCATGGAGCGCAAGTTCAGCCCCTGGATCGGGGGTTCCATCCTGGCCTCACTG
GGCACTTTCCAGCAGATGTGGATCTCCAAGCAGGAATATGAGGAGGGCGGGAAGCAGTGC
GTGGAGCGAAAGTGCCCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1375
Start on reference sequence 95
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ACTL6B
Symbol Nomenclature : ACTL6B
SYNONYM : ACTL6; BAF53B
Designation : 53 kDa BRG1-associated factor B|BRG1-associated factor 53B|actin-like 6|actin-like protein 6B|actin-related protein Baf53b|arpNalpha|hArpN alpha
Full Nomenclature : actin-like 6B
GENEID : 51412
HGNC : 160
MIM : 612458
Vega : OTTHUMG00000159661
Target GenBank: BC020944

 

Reference Sequence Alignment

  

HsCD00074347      ATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTGGTCTTTGACATTGGCTCC
NM_016188.4       ATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTGGTCTTTGACATTGGCTCC
                  ************************************************************

HsCD00074347      TTCTCAGTCCGCGCTGGGTACGCTGGGGAGGACTGTCCCAAGGCTGACTTCCCCACCACA
NM_016188.4       TTCTCAGTCCGCGCTGGGTACGCTGGGGAGGACTGTCCCAAGGCTGACTTCCCCACCACA
                  ************************************************************

HsCD00074347      GTGGGGCTGCTGGCCGCGGAGGAGGGGGGCGGGCTGGAGCTGGAGGGGGACAAAGAGAAG
NM_016188.4       GTGGGGCTGCTGGCCGCGGAGGAGGGGGGCGGGCTGGAGCTGGAGGGGGACAAAGAGAAG
                  ************************************************************

HsCD00074347      AAAGGGAAGATCTTCCACATCGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAG
NM_016188.4       AAAGGGAAGATCTTCCACATCGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAG
                  ************************************************************

HsCD00074347      GTCATGTCGCCCCTCAAGAATGGCATGATCGAGGACTGGGAGTGCTTCCGAGCCATCCTG
NM_016188.4       GTCATGTCGCCCCTCAAGAATGGCATGATCGAGGACTGGGAGTGCTTCCGAGCCATCCTG
                  ************************************************************

HsCD00074347      GATCACACCTACAGCAAACACGTCAAGTCTGAGCCAAACCTGCACCCAGTGCTCATGTCC
NM_016188.4       GATCACACCTACAGCAAACACGTCAAGTCTGAGCCAAACCTGCACCCAGTGCTCATGTCC
                  ************************************************************

HsCD00074347      GAGGCTCCGTGGAACACACGGGCCAAGCGGGAGAAGCTGACAGAGCTGATGTTCGAGCAG
NM_016188.4       GAGGCTCCGTGGAACACACGGGCCAAGCGGGAGAAGCTGACAGAGCTGATGTTCGAGCAG
                  ************************************************************

HsCD00074347      TACAACATTCCTGCCTTCTTCTTATGCAAGACGGCTGTGCTCACCGCCTTTGCAAACGGG
NM_016188.4       TACAACATTCCTGCCTTCTTCTTATGCAAGACGGCTGTGCTCACCGCCTTTGCAAACGGG
                  ************************************************************

HsCD00074347      CGGTCCACTGGCCTCGTGCTGGACAGTGGAGCCACCCACACCACGGCCATTCCAGTACAT
NM_016188.4       CGGTCCACTGGCCTCGTGCTGGACAGTGGAGCCACCCACACCACGGCCATTCCAGTACAT
                  ************************************************************

HsCD00074347      GACGGCTACGTTCTGCAGCAAGGCATCGTCAAGTCCCCTCTGGCAGGGGACTTCATCTCC
NM_016188.4       GACGGCTACGTTCTGCAGCAAGGCATCGTCAAGTCCCCTCTGGCAGGGGACTTCATCTCC
                  ************************************************************

HsCD00074347      ATGCAGTGCCGGGAGCTGTTCCAGGAGATGGCCATTGACATCATCCCACCTTACATGATC
NM_016188.4       ATGCAGTGCCGGGAGCTGTTCCAGGAGATGGCCATTGACATCATCCCACCTTACATGATC
                  ************************************************************

HsCD00074347      GCAGCCAAGGAGCCTGTCCGGGAGGGTGCCCCCCCAAACTGGAAGAAGAAGGAGAAGCTA
NM_016188.4       GCAGCCAAGGAGCCTGTCCGGGAGGGTGCCCCCCCAAACTGGAAGAAGAAGGAGAAGCTA
                  ************************************************************

HsCD00074347      CCCCAGGTCTCCAAGTCCTGGCATAACTACATGTGTAATGAGGTGATCCAGGACTTCCAG
NM_016188.4       CCCCAGGTCTCCAAGTCCTGGCATAACTACATGTGTAATGAGGTGATCCAGGACTTCCAG
                  ************************************************************

HsCD00074347      GCCTCCGTGCTGCAGGTCTCAGACTCCCCCTACGATGAACAGGTGGCTGCACAAATGCCC
NM_016188.4       GCCTCCGTGCTGCAGGTCTCAGACTCCCCCTACGATGAACAGGTGGCTGCACAAATGCCC
                  ************************************************************

HsCD00074347      ACAGTGCACTACGAGATGCCCAATGGCTACAATACAGACTACGGCGCCGAGCGACTCCGC
NM_016188.4       ACAGTGCACTACGAGATGCCCAATGGCTACAATACAGACTACGGCGCCGAGCGACTCCGC
                  ************************************************************

HsCD00074347      ATCCCTGAGGGCCTGTTTGATCCCTCGAACGTCAAGGGCCTGTCGGGGAACACCATGTTG
NM_016188.4       ATCCCTGAGGGCCTGTTTGATCCCTCGAACGTCAAGGGCCTGTCGGGGAACACCATGTTG
                  ************************************************************

HsCD00074347      GGTGTGGGCCACGTGGTGACCACCAGCATCGGCATGTGTGACATTGATATTCGCCCGGGC
NM_016188.4       GGTGTGGGCCACGTGGTGACCACCAGCATCGGCATGTGTGACATTGATATTCGCCCGGGC
                  ************************************************************

HsCD00074347      CTGTACGGGAGTGTCATTGTCACCGGCGGGAACACACTGCTGCAGGGCTTCACTGACAGG
NM_016188.4       CTGTACGGGAGTGTCATTGTCACCGGCGGGAACACACTGCTGCAGGGCTTCACTGACAGG
                  ************************************************************

HsCD00074347      CTCAATCGAGAGCTTTCCCAGAAGACCCCACCGAGCATGCGACTGAAACTCATTGCCAGC
NM_016188.4       CTCAATCGAGAGCTTTCCCAGAAGACCCCACCGAGCATGCGACTGAAACTCATTGCCAGC
                  ************************************************************

HsCD00074347      AACAGCACCATGGAGCGCAAGTTCAGCCCCTGGATCGGGGGTTCCATCCTGGCCTCACTG
NM_016188.4       AACAGCACCATGGAGCGCAAGTTCAGCCCCTGGATCGGGGGTTCCATCCTGGCCTCACTG
                  ************************************************************

HsCD00074347      GGCACTTTCCAGCAGATGTGGATCTCCAAGCAGGAATATGAGGAGGGCGGGAAGCAGTGC
NM_016188.4       GGCACTTTCCAGCAGATGTGGATCTCCAAGCAGGAATATGAGGAGGGCGGGAAGCAGTGC
                  ************************************************************

HsCD00074347      GTGGAGCGAAAGTGCCCCTAG
NM_016188.4       GTGGAGCGAAAGTGCCCCTGA
                  *******************..

Pathways

NCI : C-MYC pathway
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : HATs acetylate histones

Protein

SMART domain : ACTIN : Actin
UniProt : O96019
HPRD : 12419

Clone

Cloning Information : 212894
HIP Master Clone ID : 118021
Original Clone ID : FLH212894.01X

Organism


TAX_ID : 9606
Species Specific ID: 86

Genome

Chromosome : 7
Map Location : 7q22
Ensembl : ENSG00000077080

Reagents

Labome : ACTL6B-antibody