DNASU Plasmid Repository • 480.965.5697 | Email

PTPN1 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  PTPN1
Gene Name:  protein tyrosine phosphatase, non-receptor type 1
Original Clone ID: FLH212941.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1308nts         Open reading frame : 1 to 1308
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1425
Start on reference sequence 118
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PTPN1
Symbol Nomenclature : PTPN1
Designation : protein tyrosine phosphatase, placental|protein-tyrosine phosphatase 1B|tyrosine-protein phosphatase non-receptor type 1
Full Nomenclature : protein tyrosine phosphatase, non-receptor type 1
GENEID : 5770
HGNC : 9642
MIM : 176885
Vega : OTTHUMG00000032729
Target GenBank: BC018164


Reference Sequence Alignment

























NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : EGF receptor (ErbB1) signaling pathway
NCI : IGF1 pathway
NCI : Insulin Pathway
NCI : N-cadherin signaling events
NCI : PDGFR-beta signaling pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
Panther : Cadherin signaling pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Signal Transduction
WikiPathway : Insulin Signaling
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway


Cloning Information : 212941
HIP Master Clone ID : 27024
Original Clone ID : FLH212941.01X


TAX_ID : 9606
Species Specific ID: 5770


Chromosome : 20
Map Location : 20q13.1-q13.2
Ensembl : ENSG00000196396


Labome : PTP1B-antibody