DNASU Plasmid Repository • 480.965.5697 | Email

FGF19 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  FGF19
Gene Name:  fibroblast growth factor 19
Original Clone ID: FLH213007.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 651nts         Open reading frame : 1 to 651
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 782
Start on reference sequence 132
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : FGF19
Symbol Nomenclature : FGF19
Designation : FGF-19
Full Nomenclature : fibroblast growth factor 19
GENEID : 9965
Locus Tag : UNQ334/PRO533
HGNC : 3675
MIM : 603891
Vega : OTTHUMG00000167886
Target GenBank: BC017664


Reference Sequence Alignment














NCI : FGF signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FGFR ligand binding and activation
Reactome : FGFR4 ligand binding and activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Klotho-mediated ligand binding
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : betaKlotho-mediated ligand binding
WikiPathway : Neural Crest Differentiation


SMART domain : FGF : Acidic and basic fibroblast growth factor family.
UniProt : O95750
HPRD : 04868


Cloning Information : 213007
HIP Master Clone ID : 28026
Original Clone ID : FLH213007.01X


TAX_ID : 9606
Species Specific ID: 9965


Chromosome : 11
Map Location : 11q13.1
Ensembl : ENSG00000162344


Labome : FGF19-antibody