DNASU Plasmid Repository • 480.965.5697 | Email

HMGB1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HMGB1
Gene Name:  high mobility group box 1
Sequence             
Original Clone ID: FLH213216.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00074594

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 648nts         Open reading frame : 1 to 648

ATGGGCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTCATCATATGCATTTTTTGTG
CAAACTTGTCGGGAGGAGCATAAGAAGAAGCACCCAGATGCTTCAGTCAACTTCTCAGAG
TTTTCTAAGAAGTGCTCAGAGAGGTGGAAGACCATGTCTGCTAAAGAGAAAGGAAAATTT
GAAGATATGGCAAAAGCGGACAAGGCCCGTTATGAAAGAGAAATGAAAACCTATATCCCT
CCCAAAGGGGAGACAAAAAAGAAGTTCAAGGATCCCAATGCACCCAAGAGGCCTCCTTCG
GCCTTCTTCCTCTTCTGCTCTGAGTATCGCCCAAAAATCAAAGGAGAACATCCTGGCCTA
TCCATTGGTGATGTTGCGAAGAAACTGGGAGAGATGTGGAATAACACTGCTGCAGATGAC
AAGCAGCCTTATGAAAAGAAGGCTGCGAAGCTGAAGGAAAAATACGAAAAGGATATTGCT
GCATATCGAGCTAAAGGAAAGCCTGATGCAGCAAAAAAGGGAGTTGTCAAGGCTGAAAAA
AGCAAGAAAAAGAAGGAAGAGGAGGAAGATGAGGAAGATGAAGAGGATGAGGAGGAGGAG
GAAGATGAAGAAGATGAAGATGAAGAAGAAGATGATGATGATGAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 700
Start on reference sequence 53
Mutations:
None
Discrepancy:
g360a; a477t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HMGB1
Symbol Nomenclature : HMGB1
SYNONYM : HMG1; HMG3; SBP-1
Designation : Amphoterin|HMG-1|Sulfoglucuronyl carbohydrate binding protein|high mobility group protein 1|high mobility group protein B1|high-mobility group (nonhistone chromosomal) protein 1|high-mobility group box 1
Full Nomenclature : high mobility group box 1
GENEID : 3146
Locus Tag : RP11-550P23.1
HGNC : 4983
MIM : 163905
Vega : OTTHUMG00000016670
Target GenBank: NM_002128

 

Pathways

NCI : Beta3 integrin cell surface interactions
NCI : Endogenous TLR signaling
NCI : amb2 Integrin signaling
Panther : p53 pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of DNA fragmentation factor
Reactome : Advanced glycosylation endproduct receptor signaling
Reactome : Apoptosis
Reactome : Apoptosis induced DNA fragmentation
Reactome : Apoptotic execution phase
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DEx/H-box helicases activate type I IFN and inflammatory cytokines production
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : DNA damage response (only ATM dependent)

Protein

SMART domain : HMG : high mobility group
UniProt : P09429
HPRD : 01228

Clone

Cloning Information : 213216
HIP Master Clone ID : 6799
Original Clone ID : FLH213216.01X

Organism


TAX_ID : 9606
Species Specific ID: 3146

Genome

Chromosome : 13
Map Location : 13q12
Ensembl : ENSG00000189403

Reagents

Labome : HMGB1-antibody