DNASU Plasmid Repository • 480.965.5697 | Email

UBE2I (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBE2I
Gene Name:  ubiquitin-conjugating enzyme E2I
Sequence             
Original Clone ID: FLH213252.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074617

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 555nts         Open reading frame : 1 to 555
Reference Sequence Alignment

ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCAC
CCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAAC
TGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTA
CGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCA
TTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGAC
AAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTA
AATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGGTTAGTA
GCAGCCCTGGCCCCGCTGGTGGCAGCTCCTCCCCGTCCCAGCCAAGGCCGCCTGGCAGGA
CGGGAGTGGAGCACACAGGCTCACCCTAGGGACAGCCAGGGTCCGCGCCTCTGTGGGGAA
GGTCGGGGGGCATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 591
Start on reference sequence 37
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBE2I
Symbol Nomenclature : UBE2I
SYNONYM : C358B7.1; P18; UBC9
Designation : SUMO-1-protein ligase|SUMO-conjugating enzyme UBC9|SUMO-protein ligase|ubiquitin carrier protein 9|ubiquitin carrier protein I|ubiquitin conjugating enzyme 9|ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)|ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)|ubiquitin-conjugating enzyme UbcE2A|ubiquitin-like protein SUMO-1 conjugating enzyme|ubiquitin-protein ligase E2I|ubiquitin-protein ligase I
Full Nomenclature : ubiquitin-conjugating enzyme E2I
GENEID : 7329
Locus Tag : LA16c-358B7.1
HGNC : 12485
MIM : 601661
Vega : OTTHUMG00000047845
Target GenBank: BC004437

 

Reference Sequence Alignment

  

HsCD00074617        ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCAC
XM_005255540.1      ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCAC
                    ************************************************************

HsCD00074617        CCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAAC
XM_005255540.1      CCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAAC
                    ************************************************************

HsCD00074617        TGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTA
XM_005255540.1      TGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTA
                    ************************************************************

HsCD00074617        CGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCA
XM_005255540.1      CGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCA
                    ************************************************************

HsCD00074617        TTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGAC
XM_005255540.1      TTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGAC
                    ************************************************************

HsCD00074617        AAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTA
XM_005255540.1      AAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTA
                    ************************************************************

HsCD00074617        AATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGGTTAGTA
XM_005255540.1      AATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGGTTAGTA
                    ************************************************************

HsCD00074617        GCAGCCCTGGCCCCGCTGGTGGCAGCTCCTCCCCGTCCCAGCCAAGGCCGCCTGGCAGGA
XM_005255540.1      GCAGCCCTGGCCCCGCTGGTGGCAGCTCCTCCCCGTCCCAGCCAAGGCCGCCTGGCAGGA
                    ************************************************************

HsCD00074617        CGGGAGTGGAGCACACAGGCTCACCCTAGGGACAGCCAGGGTCCGCGCCTCTGTGGGGAA
XM_005255540.1      CGGGAGTGGAGGACACAGGCTCACCCTACGGACAGCCAGGGTCCACGCCTCTGTGGGGAA
                    *********** **************** ***************.***************

HsCD00074617        GGTCGGGGGGCATAG
XM_005255540.1      GGTCGGGGGGCATAA
                    **************.

Pathways

NCI : C-MYB transcription factor network
NCI : Coregulation of Androgen receptor activity
NCI : Regulation of cytoplasmic and nuclear SMAD2/3 signaling
NCI : Signaling events mediated by HDAC Class I
NCI : Signaling events mediated by HDAC Class II
NCI : Sumoylation by RanBP2 regulates transcriptional repression
Reactome : Cell Cycle
Reactome : Meiosis
Reactome : Meiotic synapsis
Reactome : Metabolism of proteins
Reactome : Post-translational protein modification
Reactome : Processing and activation of SUMO
Reactome : SUMO is transferred from E1 to E2 (UBE2I, UBC9)
Reactome : SUMOylation
WikiPathway : Androgen receptor signaling pathway
WikiPathway : TGF beta Signaling Pathway

Clone

Cloning Information : 213252
HIP Master Clone ID : 29576
Original Clone ID : FLH213252.01X

Organism


TAX_ID : 9606
Species Specific ID: 7329

Genome

Chromosome : 16
Map Location : 16p13.3
Ensembl : ENSG00000103275

Reagents

Labome : UBE2I-antibody