DNASU Plasmid Repository • 480.965.5697 | Email

IGFBP7 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IGFBP7
Gene Name:  insulin-like growth factor binding protein 7
Sequence             
Original Clone ID: FLH213392.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074718

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 849nts         Open reading frame : 1 to 849
Reference Sequence Alignment

ATGGAGCGGCCGTCGCTGCGCGCCCTGCTCCTCGGCGCCGCTGGGCTGCTGCTCCTGCTC
CTGCCCCTCTCCTCTTCCTCCTCTTCGGACACCTGCGGCCCCTGCGAGCCGGCCTCCTGC
CCGCCCCTGCCCCCGCTGGGCTGCCTGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGC
CCTATGTGCGCCCGCGGCGAGGGCGAGCCGTGCGGGGGTGGCGGCGCCGGCAGGGGGTAC
TGCGCGCCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCCGGGGCA
GCAGCCGGCGGTCCGGGTGTAAGCGGCGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGC
GGCAGCGACGGCACCACCTACCCGAGCGGCTGCCAGCTGCGCGCCGCCAGCCAGAGGGCC
GAGAGCCGCGGGGAGAAGGCCATCACCCAGGTCAGCAAGGGCACCTGCGAGCAAGGTCCT
TCCATAGTGACGCCCCCCAAGGACATCTGGAATGTCACTGGTGCCCAGGTGTACTTGAGC
TGTGAGGTCATCGGAATCCCGACACCTGTCCTCATCTGGAACAAGGTAAAAAGGGGTCAC
TATGGAGTTCAAAGGACAGAACTCCTGCCTGGTGACCGGGACAACCTGGCCATTCAGACC
CGGGGTGGCCCAGAAAAGCATGAAGTAACTGGCTGGGTGCTGGTATCTCCTCTAAGTAAG
GAAGATGCTGGAGAATATGAGTGCCATGCATCCAATTCCCAAGGACAGGCTTCAGCATCA
GCAAAAATTACAGTGGTTGATGCCTTACATGAAATACCAGTGAAAAAAGGTGAAGGTGCC
GAGCTATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 880
Start on reference sequence 32
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IGFBP7
Symbol Nomenclature : IGFBP7
SYNONYM : AGM; FSTL2; IBP-7; IGFBP-7; IGFBP-7v; IGFBPRP1; MAC25; PSF; RAMSVPS; TAF
Designation : IGF-binding protein 7|IGFBP-rP1|PGI2-stimulating factor|angiomodulin|insulin-like growth factor-binding protein 7|prostacyclin-stimulating factor|tumor-derived adhesion factor
Full Nomenclature : insulin-like growth factor binding protein 7
GENEID : 3490
HGNC : 5476
MIM : 602867
Target GenBank: BC017201

 

Reference Sequence Alignment

  

HsCD00074718        ATGGAGCGGCCGTCGCTGCGCGCCCTGCTCCTCGGCGCCGCTGGGCTGCTGCTCCTGCTC
NM_001553.2         ATGGAGCGGCCGTCGCTGCGCGCCCTGCTCCTCGGCGCCGCTGGGCTGCTGCTCCTGCTC
NM_001253835.1      ATGGAGCGGCCGTCGCTGCGCGCCCTGCTCCTCGGCGCCGCTGGGCTGCTGCTCCTGCTC
                    ************************************************************

HsCD00074718        CTGCCCCTCTCCTCTTCCTCCTCTTCGGACACCTGCGGCCCCTGCGAGCCGGCCTCCTGC
NM_001553.2         CTGCCCCTCTCCTCTTCCTCCTCTTCGGACACCTGCGGCCCCTGCGAGCCGGCCTCCTGC
NM_001253835.1      CTGCCCCTCTCCTCTTCCTCCTCTTCGGACACCTGCGGCCCCTGCGAGCCGGCCTCCTGC
                    ************************************************************

HsCD00074718        CCGCCCCTGCCCCCGCTGGGCTGCCTGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGC
NM_001553.2         CCGCCCCTGCCCCCGCTGGGCTGCCTGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGC
NM_001253835.1      CCGCCCCTGCCCCCGCTGGGCTGCCTGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGC
                    ************************************************************

HsCD00074718        CCTATGTGCGCCCGCGGCGAGGGCGAGCCGTGCGGGGGTGGCGGCGCCGGCAGGGGGTAC
NM_001553.2         CCTATGTGCGCCCGCGGCGAGGGCGAGCCGTGCGGGGGTGGCGGCGCCGGCAGGGGGTAC
NM_001253835.1      CCTATGTGCGCCCGCGGCGAGGGCGAGCCGTGCGGGGGTGGCGGCGCCGGCAGGGGGTAC
                    ************************************************************

HsCD00074718        TGCGCGCCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCCGGGGCA
NM_001553.2         TGCGCGCCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCCGGGGCA
NM_001253835.1      TGCGCGCCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCCGGGGCA
                    ************************************************************

HsCD00074718        GCAGCCGGCGGTCCGGGTGTAAGCGGCGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGC
NM_001553.2         GCAGCCGGCGGTCCGGGTGTAAGCGGCGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGC
NM_001253835.1      GCAGCCGGCGGTCCGGGTGTAAGCGGCGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGC
                    ************************************************************

HsCD00074718        GGCAGCGACGGCACCACCTACCCGAGCGGCTGCCAGCTGCGCGCCGCCAGCCAGAGGGCC
NM_001553.2         GGCAGCGACGGCACCACCTACCCGAGCGGCTGCCAGCTGCGCGCCGCCAGCCAGAGGGCC
NM_001253835.1      GGCAGCGACGGCACCACCTACCCGAGCGGCTGCCAGCTGCGCGCCGCCAGCCAGAGGGCC
                    ************************************************************

HsCD00074718        GAGAGCCGCGGGGAGAAGGCCATCACCCAGGTCAGCAAGGGCACCTGCGAGCAAGGTCCT
NM_001553.2         GAGAGCCGCGGGGAGAAGGCCATCACCCAGGTCAGCAAGGGCACCTGCGAGCAAGGTCCT
NM_001253835.1      GAGAGCCGCGGGGAGAAGGCCATCACCCAGGTCAGCAAGGGCACCTGCGAGCAAGGTCCT
                    ************************************************************

HsCD00074718        TCCATAGTGACGCCCCCCAAGGACATCTGGAATGTCACTGGTGCCCAGGTGTACTTGAGC
NM_001553.2         TCCATAGTGACGCCCCCCAAGGACATCTGGAATGTCACTGGTGCCCAGGTGTACTTGAGC
NM_001253835.1      TCCATAGTGACGCCCCCCAAGGACATCTGGAATGTCACTGGTGCCCAGGTGTACTTGAGC
                    ************************************************************

HsCD00074718        TGTGAGGTCATCGGAATCCCGACACCTGTCCTCATCTGGAACAAGGTAAAAAGGGGTCAC
NM_001553.2         TGTGAGGTCATCGGAATCCCGACACCTGTCCTCATCTGGAACAAGGTAAAAAGGGGTCAC
NM_001253835.1      TGTGAGGTCATCGGAATCCCGACACCTGTCCTCATCTGGAACAAGGTAAAAAGGGGTCAC
                    ************************************************************

HsCD00074718        TATGGAGTTCAAAGGACAGAACTCCTGCCTGGTGACCGGGACAACCTGGCCATTCAGACC
NM_001553.2         TATGGAGTTCAAAGGACAGAACTCCTGCCTGGTGACCGGGACAACCTGGCCATTCAGACC
NM_001253835.1      TATGGAGTTCAAAGGACAGAACTCCTGCCTGGTGACCGGGACAACCTGGCCATTCAGACC
                    ************************************************************

HsCD00074718        CGGGGTGGCCCAGAAAAGCATGAAGTAACTGGCTGGGTGCTGGTATCTCCTCTAAGTAAG
NM_001553.2         CGGGGTGGCCCAGAAAAGCATGAAGTAACTGGCTGGGTGCTGGTATCTCCTCTAAGTAAG
NM_001253835.1      CGGGGTGGCCCAGAAAAGCATGAAGTAACTGGCTGGGTGCTGGTATCTCCTCTAAGTAAG
                    ************************************************************

HsCD00074718        GAAGATGCTGGAGAATATGAGTGCCATGCATCCAATTCCCAAGGACAGGCTTCAGCATCA
NM_001553.2         GAAGATGCTGGAGAATATGAGTGCCATGCATCCAATTCCCAAGGACAGGCTTCAGCATCA
NM_001253835.1      GAAGATGCTGGAGAATATGAGTGCCATGCATCCAATTCCCAAGGACAGGCTTCAGCATCA
                    ************************************************************

HsCD00074718        GCAAAAATTACAGTGGTTGATGCCTTACATGAAATACCAGTGAAAAAAGGTGAAGGTGCC
NM_001553.2         GCAAAAATTACAGTGGTTGATGCCTTACATGAAATACCAGTGAAAAAAGGTGAAGGTGCC
NM_001253835.1      GCAAAAATTACAGTGGTTGATGCCTTACATGAAATACCAGTGAAAAAAGGTACACAATAA
                    ***************************************************..* .: ..

HsCD00074718        GAGCTATAG
NM_001553.2         GAGCTATAA
NM_001253835.1      ---------
                             

Pathways

Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Senescence-Associated Secretory Phenotype (SASP)
WikiPathway : Senescence and Autophagy

Clone

Cloning Information : 213392
HIP Master Clone ID : 55028
Original Clone ID : FLH213392.01X

Organism


TAX_ID : 9606
Species Specific ID: 3490

Genome

Chromosome : 4
Map Location : 4q12
Ensembl : ENSG00000163453

Reagents

Labome : IGFBP7-antibody