DNASU Plasmid Repository • 480.965.5697 | Email

IFNG (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IFNG
Gene Name:  interferon, gamma
Sequence             
Original Clone ID: FLH217845.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074800

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 501nts         Open reading frame : 1 to 501
Reference Sequence Alignment

ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
GGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAA
GAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTT
AAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG
AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAAT
TATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATG
GCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCAA
GGTCGAAGAGCATCCCAGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 609
Start on reference sequence 109
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IFNG
Symbol Nomenclature : IFNG
SYNONYM : IFG; IFI
Designation : IFN-gamma|immune interferon|interferon gamma
Full Nomenclature : interferon, gamma
GENEID : 3458
HGNC : 5438
MIM : 147570
Vega : OTTHUMG00000169113
Target GenBank: NM_000619

 

Reference Sequence Alignment

  

HsCD00074800      ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
NM_000619.2       ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
                  ************************************************************

HsCD00074800      TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
NM_000619.2       TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
                  ************************************************************

HsCD00074800      GGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAA
NM_000619.2       GGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAA
                  ************************************************************

HsCD00074800      GAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTT
NM_000619.2       GAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTT
                  ************************************************************

HsCD00074800      AAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG
NM_000619.2       AAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG
                  ************************************************************

HsCD00074800      AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAAT
NM_000619.2       AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAAT
                  ************************************************************

HsCD00074800      TATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATG
NM_000619.2       TATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATG
                  ************************************************************

HsCD00074800      GCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCAA
NM_000619.2       GCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCGA
                  **********************************************************.*

HsCD00074800      GGTCGAAGAGCATCCCAGTAA
NM_000619.2       GGTCGAAGAGCATCCCAGTAA
                  *********************

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Calcium signaling in the CD4+ TCR pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Glucocorticoid receptor regulatory network
NCI : IFN-gamma pathway
NCI : IL12 signaling mediated by STAT4
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL27-mediated signaling events
NCI : PDGFR-alpha signaling pathway
NCI : Regulation of Telomerase
NCI : SHP2 signaling
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interferon-gamma signaling pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : Regulation of IFNG signaling
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : Folate Metabolism
WikiPathway : Hypertrophy Model
WikiPathway : Inflammatory Response Pathway
WikiPathway : Proteasome Degradation
WikiPathway : Selenium Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : Type II interferon signaling (IFNG)
WikiPathway : Vitamin B12 Metabolism

Protein

UniProt : P01579
HPRD : 00957

Clone

Cloning Information : 217845
HIP Master Clone ID : 61578
Original Clone ID : FLH217845.01X

Organism


TAX_ID : 9606
Species Specific ID: 3458

Genome

Chromosome : 12
Map Location : 12q14
Ensembl : ENSG00000111537

Reagents

Labome : IFN-gamma-antibody