DNASU Plasmid Repository • 480.965.5697 | Email

BIRC5 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BIRC5
Gene Name:  baculoviral IAP repeat containing 5
Sequence             
Original Clone ID: FLH217857.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 23204226
Title: Trastuzumab-Resistant Cells Rely on a HER2-PI3K-FoxO-Survivin Axis and Are Sensitive to PI3K Inhibitors
Authors:
HsCD00074849

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 429nts         Open reading frame : 1 to 429
Reference Sequence Alignment

ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT
TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA
TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG
AAGAAAGAATTTGAGGAAACTGCGAAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC
ATGGATTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 473
Start on reference sequence 45
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BIRC5
Symbol Nomenclature : BIRC5
SYNONYM : API4; EPR-1
Designation : apoptosis inhibitor 4|apoptosis inhibitor survivin|baculoviral IAP repeat-containing protein 5|survivin variant 3 alpha
Full Nomenclature : baculoviral IAP repeat containing 5
GENEID : 332
HGNC : 593
MIM : 603352
Vega : OTTHUMG00000177505
Target GenBank: BC034148

 

Reference Sequence Alignment

  

HsCD00074849        ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
NM_001168.2         ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
NM_001012270.1      ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
                    ************************************************************

HsCD00074849        ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
NM_001168.2         ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
NM_001012270.1      ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
                    ************************************************************

HsCD00074849        GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
NM_001168.2         GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
NM_001012270.1      GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
                    ************************************************************

HsCD00074849        TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT
NM_001168.2         TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT
NM_001012270.1      TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATGCAAAGGAAACCAACAATA
                    *****************************************. *.....*:..**...::

HsCD00074849        TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA
NM_001168.2         TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA
NM_001012270.1      AG------------AAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCG
                    :             :: ..: :.* * *.***.*:*   ..*.*.* ..** *   : ..

HsCD00074849        TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG
NM_001168.2         TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG
NM_001012270.1      AGCAGCTGGCTGCCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTG
                    :  :  :..*** ..:*..::...***:. ..*...*    ..:**:..*..* :. .:*

HsCD00074849        AAGAAAGAATTTGAGGAAACTGCGAAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC
NM_001168.2         AAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC
NM_001012270.1      CACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATG
                    .* .*. :. : *.  :*:   * .. ....  .*** * * .* *. *.  *.**:.  

HsCD00074849        ATGGATTGA
NM_001168.2         ATGGATTGA
NM_001012270.1      TCTTAG---
                    :   *    

Pathways

NCI : Aurora A signaling
NCI : Aurora B signaling
NCI : FOXM1 transcription factor network
NCI : Validated targets of C-MYC transcriptional activation
Panther : Angiogenesis
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : IL-4 signaling pathway

Protein

SMART domain : BIR : Baculoviral inhibition of apoptosis protein repeat
UniProt : O15392
HPRD : 04520

Clone

Cloning Information : 217857
HIP Master Clone ID : 32796
Original Clone ID : FLH217857.01X

Organism


TAX_ID : 9606
Species Specific ID: 332

Genome

Chromosome : 17
Map Location : 17q25
Ensembl : ENSG00000089685

Reagents

Labome : survivin-antibody