DNASU Plasmid Repository • 480.965.5697 | Email

UNRIP (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  STRAP
Gene Name:  serine/threonine kinase receptor associated protein
Sequence             
Original Clone ID: FLH217905.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00074885

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1053nts         Open reading frame : 1 to 1053
Reference Sequence Alignment

ATGGCAATGAGACAGACGCCGCTCACCTGCTCTGGCCACACGCGACCCGTGGTTGATTTG
GCCTTCAGTGGCATCACGCCTTATGGGTATTTCTTAATCAGCGCTTGCAAAGATGGTAAA
CCTATGCTACGCCAGGGAGATACAGGAGACTGGATTGGAACATTTTTGGGTCATAAAGGT
GCTGTTTGGGGTGCAACACTGAATAAGGATGCCACCAAAGCAGCTACAGCAGCTGCAGAT
TTCACAGCCAAAGTGTGGGATGCTGTCTCAGGAGATGAATTGATGACCCTGGCTCATAAA
CACATTGTCAAGACTGTGGATTTCACGCAGGATAGTAATTATTTGTTAACCGGGGGACAG
GATAAACTGTTACGCATATATGACTTGAACAAACCTGAAGCAGAACCTAAGGAAATTAGT
GGTCATACTTCTGGTATAAAAAAAGCTCTGTGGTGCAGTGAGGATAAACAGATTCTTTCT
GCTGATGACAAAACTGTTCGACTTTGGGATCATGCTACTATGACAGAAGTGAAATCTCTA
AATTTTAATATGTCTGTTAGTAGTATGGAATATATTCCTGAGGGAGAGATTTTGGTTATA
ACTTATGGACGATCTATTGCTTTTCATAGTGCAGTAAGTTTGGACCCAATTAAATCCTTT
GAAGCTCCTGCAACCATCAATTCTGCATCTCTTCATCCTGAGAAAGAATTTCTTGTTGCA
GGCGGTGAAGATTTTAAACTTTATAAGTATGATTATAATAGTGGAGAAGAATTAGAATCC
TACAAGGGACACTTTGGTCCTATTCACTGTGTGAGATTTAGTCCTGATGGAGAACTCTAT
GCCAGTGGTTCAGAAGATGGAACATTGAGACTATGGCAAACTGTGGTAGGAAAAACGTAT
GGCCTTTGGAAATGTGTGCTTCCTGAAGAAGATAGTGGTGAGCTGGCAAAGCCAAAGATT
GGTTTTCCAGAGACAACAGAAGAGGAGCTAGAAGAAATTGCTTCAGAGAATTCAGATTGC
ATCTTTCCTTCAGCTCCTGATGTTAAGGCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1200
Start on reference sequence 148
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : STRAP
Symbol Nomenclature : STRAP
SYNONYM : MAWD; PT-WD; UNRIP
Designation : MAP activator with WD repeats|WD-40 repeat protein PT-WD|serine-threonine kinase receptor-associated protein|unr-interacting protein
Full Nomenclature : serine/threonine kinase receptor associated protein
GENEID : 11171
HGNC : 30796
MIM : 605986
Vega : OTTHUMG00000168791
Target GenBank: NM_007178

 

Reference Sequence Alignment

  

HsCD00074885      ATGGCAATGAGACAGACGCCGCTCACCTGCTCTGGCCACACGCGACCCGTGGTTGATTTG
NM_007178.3       ATGGCAATGAGACAGACGCCGCTCACCTGCTCTGGCCACACGCGACCCGTGGTTGATTTG
                  ************************************************************

HsCD00074885      GCCTTCAGTGGCATCACGCCTTATGGGTATTTCTTAATCAGCGCTTGCAAAGATGGTAAA
NM_007178.3       GCCTTCAGTGGCATCACGCCTTATGGGTATTTCTTAATCAGCGCTTGCAAAGATGGTAAA
                  ************************************************************

HsCD00074885      CCTATGCTACGCCAGGGAGATACAGGAGACTGGATTGGAACATTTTTGGGTCATAAAGGT
NM_007178.3       CCTATGCTACGCCAGGGAGATACAGGAGACTGGATTGGAACATTTTTGGGTCATAAAGGT
                  ************************************************************

HsCD00074885      GCTGTTTGGGGTGCAACACTGAATAAGGATGCCACCAAAGCAGCTACAGCAGCTGCAGAT
NM_007178.3       GCTGTTTGGGGTGCAACACTGAATAAGGATGCCACCAAAGCAGCTACAGCAGCTGCAGAT
                  ************************************************************

HsCD00074885      TTCACAGCCAAAGTGTGGGATGCTGTCTCAGGAGATGAATTGATGACCCTGGCTCATAAA
NM_007178.3       TTCACAGCCAAAGTGTGGGATGCTGTCTCAGGAGATGAATTGATGACCCTGGCTCATAAA
                  ************************************************************

HsCD00074885      CACATTGTCAAGACTGTGGATTTCACGCAGGATAGTAATTATTTGTTAACCGGGGGACAG
NM_007178.3       CACATTGTCAAGACTGTGGATTTCACGCAGGATAGTAATTATTTGTTAACCGGGGGACAG
                  ************************************************************

HsCD00074885      GATAAACTGTTACGCATATATGACTTGAACAAACCTGAAGCAGAACCTAAGGAAATTAGT
NM_007178.3       GATAAACTGTTACGCATATATGACTTGAACAAACCTGAAGCAGAACCTAAGGAAATTAGT
                  ************************************************************

HsCD00074885      GGTCATACTTCTGGTATAAAAAAAGCTCTGTGGTGCAGTGAGGATAAACAGATTCTTTCT
NM_007178.3       GGTCATACTTCTGGTATAAAAAAAGCTCTGTGGTGCAGTGAGGATAAACAGATTCTTTCT
                  ************************************************************

HsCD00074885      GCTGATGACAAAACTGTTCGACTTTGGGATCATGCTACTATGACAGAAGTGAAATCTCTA
NM_007178.3       GCTGATGACAAAACTGTTCGACTTTGGGATCATGCTACTATGACAGAAGTGAAATCTCTA
                  ************************************************************

HsCD00074885      AATTTTAATATGTCTGTTAGTAGTATGGAATATATTCCTGAGGGAGAGATTTTGGTTATA
NM_007178.3       AATTTTAATATGTCTGTTAGTAGTATGGAATATATTCCTGAGGGAGAGATTTTGGTTATA
                  ************************************************************

HsCD00074885      ACTTATGGACGATCTATTGCTTTTCATAGTGCAGTAAGTTTGGACCCAATTAAATCCTTT
NM_007178.3       ACTTATGGACGATCTATTGCTTTTCATAGTGCAGTAAGTTTGGACCCAATTAAATCCTTT
                  ************************************************************

HsCD00074885      GAAGCTCCTGCAACCATCAATTCTGCATCTCTTCATCCTGAGAAAGAATTTCTTGTTGCA
NM_007178.3       GAAGCTCCTGCAACCATCAATTCTGCATCTCTTCATCCTGAGAAAGAATTTCTTGTTGCA
                  ************************************************************

HsCD00074885      GGCGGTGAAGATTTTAAACTTTATAAGTATGATTATAATAGTGGAGAAGAATTAGAATCC
NM_007178.3       GGCGGTGAAGATTTTAAACTTTATAAGTATGATTATAATAGTGGAGAAGAATTAGAATCC
                  ************************************************************

HsCD00074885      TACAAGGGACACTTTGGTCCTATTCACTGTGTGAGATTTAGTCCTGATGGAGAACTCTAT
NM_007178.3       TACAAGGGACACTTTGGTCCTATTCACTGTGTGAGATTTAGTCCTGATGGAGAACTCTAT
                  ************************************************************

HsCD00074885      GCCAGTGGTTCAGAAGATGGAACATTGAGACTATGGCAAACTGTGGTAGGAAAAACGTAT
NM_007178.3       GCCAGTGGTTCAGAAGATGGAACATTGAGACTATGGCAAACTGTGGTAGGAAAAACGTAT
                  ************************************************************

HsCD00074885      GGCCTTTGGAAATGTGTGCTTCCTGAAGAAGATAGTGGTGAGCTGGCAAAGCCAAAGATT
NM_007178.3       GGCCTTTGGAAATGTGTGCTTCCTGAAGAAGATAGTGGTGAGCTGGCAAAGCCAAAGATT
                  ************************************************************

HsCD00074885      GGTTTTCCAGAGACAACAGAAGAGGAGCTAGAAGAAATTGCTTCAGAGAATTCAGATTGC
NM_007178.3       GGTTTTCCAGAGACAACAGAAGAGGAGCTAGAAGAAATTGCTTCAGAGAATTCAGATTGC
                  ************************************************************

HsCD00074885      ATCTTTCCTTCAGCTCCTGATGTTAAGGCCTGA
NM_007178.3       ATCTTTCCTTCAGCTCCTGATGTTAAGGCCTGA
                  *********************************

Pathways

NCI : TGF-beta receptor signaling
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer

Protein

SMART domain : WD40 : WD40 repeats
UniProt : Q9Y3F4
HPRD : 05816

Clone

Cloning Information : 217905
HIP Master Clone ID : 93700
Original Clone ID : FLH217905.01X

Organism


TAX_ID : 9606
Species Specific ID: 11171

Genome

Chromosome : 12
Map Location : 12p12.3
Ensembl : ENSG00000023734

Reagents

Labome : STRAP-antibody