DNASU Plasmid Repository • 480.965.5697 | Email

PDGFRB (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PDGFRB
Gene Name:  platelet-derived growth factor receptor, beta polypeptide
Sequence             
Original Clone ID: FLH217982.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00074943

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3321nts         Open reading frame : 1 to 3321
Reference Sequence Alignment

ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT
CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCCTGGTCGTCACACCCCCGGGGCCA
GAGCTTGTCCTCAATGTCTCCAGCACCTTCGTTCTGACCTGCTCGGGTTCAGCTCCGGTG
GTGTGGGAACGGATGTCCCAGGAGCCCCCACAGGAAATGGCCAAGGCCCAGGATGGCACC
TTCTCCAGCGTGCTCACACTGACCAACCTCACTGGGCTAGACACGGGAGAATACTTTTGC
ACCCACAATGACTCCCGTGGACTGGAGACCGATGAGCGGAAACGGCTCTACATCTTTGTG
CCAGATCCCACCGTGGGCTTCCTCCCTAATGATGCCGAGGAACTATTCATCTTTCTCACG
GAAATAACTGAGATCACCATTCCATGCCGAGTAACAGACCCACAGCTGGTGGTGACACTG
CACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTTT
GGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGAT
TCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCA
GTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAAT
GAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCG
GTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGT
GCCGAGTTAGAAGACTCGGGGACCTACACCTGCAATGTGACGGAGAGTGTGAATGACCAT
CAGGATGAAAAGGCCATCAACATCACCGTGGTTGAGAGCGGCTACGTGCGGCTCCTGGGA
GAGGTGGGCACACTACAATTTGCTGAGCTGCATCGGAGCCGGACACTGCAGGTAGTGTTC
GAGGCCTACCCACCGCCCACTGTCCTGTGGTTCAAAGACAACCGCACCCTGGGCGACTCC
AGCGCTGGCGAAATCGCCCTGTCCACGCGCAACGTGTCGGAGACCCGGTATGTGTCAGAG
CTGACACTGGTTCGCGTGAAGGTGGCAGAGGCTGGCCACTACACCATGCGGGCCTTCCAT
GAGGATGCTGAGGTCCAGCTCTCCTTCCAGCTACAGATCAATGTCCCTGTCCGAGTGCTG
GAGCTAAGTGAGAGCCACCCTGACAGTGGGGAACAGACAGTCCGCTGTCGTGGCCGGGGC
ATGCCCCAGCCGAACATCATCTGGTCTGCCTGCAGAGACCTCAAAAGGTGTCCACGTGAG
CTGCCGCCCACGCTGCTGGGGAACAGTTCCGAAGAGGAGAGCCAGCTGGAGACTAACGTG
ACGTACTGGGAGGAGGAGCAGGAGTTTGAGGTGGTGAGCACACTGCGTCTGCAGCACGTG
GATCGGCCACTGTCGGTGCGCTGCACGCTGCGCAACGCTGTGGGCCAGGACACGCAGGAG
GTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCC
CTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCA
CGTTACGAGATCCGATGGAAGGTGATTGAGTCTGTGAGCTCTGACGGCCATGAGTACATC
TACGTGGACCCCATGCAGCTGCCCTATGACTCCACGTGGGAGCTGCCGCGGGACCAGCTT
GTGCTGGGACGCACCCTCGGCTCTGGGGCCTTTGGGCAGGTGGTGGGGGCCACGGCTCAT
GGCCTGAGCCATTCTCAGGCCACGATGAAAGTGGCCGTCAAGATGCTTAAATCCACAGCC
CGCAGCAGTGAGAAGCAAGCCCTTATGTCGGAGCTGAAGATCATGAGTCACCTTGGGCCC
CACCTGAACGTGGTCAACCTGTTGGGGGCCTGCACCAAAGGAGGACCCATCTATATCATC
ACTGAGTACTGCCGCTACGGAGACCTGGTGGACTACCTGCACCGCAACAAACACACCTTC
CTGCAGCACCACTCCGACAAGCGCCGCCCGCCCAGCGCGGAGCTCTACAGCAATGCTCTG
CCCGTTGGGCTCCCCCTGCCCAGCCATGTGTCCTTGACCGGGGAGAGCGACGGTGGCTAC
ATGGACATGAGCAAGGACGAGTCGGTGGACTATGTGCCCATGCTGGACATGAAAGGAGAC
GTCAAATATGCAGACATCGAGTCCTCCAACTACATGGCCCCTTACGATAACTACGTTCCC
TCTGCCCCTGAGAGGACCTGCCGAGCAACTTTGATCAACGAGTCTCCAGTGCTAAGCTAC
ATGGACCTCGTGGGCTTCAGCTACCAGGTGGCCAATGGCATGGAGTTTCTGGCCTCCAAG
AACTGCGTCCACAGAGACCTGGCGGCTAGGAACGTGCTCATCTGTGAAGGCAAGCTGGTC
AAGATCTGTGACTTTGGCCTGGCTCGAGACATCATGCGGGACTCGAATTACATCTCCAAA
GGCAGCACCTTTTTGCCTTTAAAGTGGATGGCTCCGGAGAGCATCTTCAACAGCCTCTAC
ACCACCCTGAGCGACGTGTGGTCCTTCGGGATCCTGCTCTGGGAGATCTTCACCTTGGGT
GGCACCCCTTACCCAGAGCTGCCCATGAACGAGCAGTTCTACAATGCCATCAAACGGGGT
TACCGCATGGCCCAGCCTGCCCATGCCTCCGACGAGATCTATGAGATCATGCAGAAGTGC
TGGGAAGAGAAGTTTGAGATTCGGCCCCCCTTCTCCCAGCTGGTGCTGCTTCTCGAGAGA
CTGTTGGGCGAAGGTTACAAAAAGAAGTACCAGCAGGTGGATGAGGAGTTTCTGAGGAGT
GACCACCCAGCCATCCTTCGGTCCCAGGCCCGCTTGCCTGGGTTCCATGGCCTCCGATCT
CCCCTGGACACCAGCTCCGTCCTCTATACTGCCGTGCAGCCCAATGAGGGTGACAACGAC
TATATCATCCCCCTGCCTGACCCCAAACCCGAGGTTGCTGACGAGGGCCCACTGGAGGGT
TCCCCCAGCCTAGCCAGCTCCACCCTGAATGAAGTCAACACCTCCTCAACCATCTCCTGT
GACAGCCCCCTGGAGCCCCAGGACGAACCAGAGCCAGAGCCCCAGCTTGAGCTCCAGGTG
GAGCCGGAGCCAGAGCTGGAACAGTTGCCGGATTCGGGGTGCCCTGCGCCTCGGGCGGAA
GCAGAGGATAGCTTCCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 3796
Start on reference sequence 476
Mutations:
None
Discrepancy:
a1847g,E616G
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PDGFRB
Symbol Nomenclature : PDGFRB
SYNONYM : CD140B; IBGC4; IMF1; JTK12; PDGFR; PDGFR-1; PDGFR1
Designation : CD140 antigen-like family member B|PDGF-R-beta|PDGFR-beta|beta-type platelet-derived growth factor receptor|platelet-derived growth factor receptor 1|platelet-derived growth factor receptor beta
Full Nomenclature : platelet-derived growth factor receptor, beta polypeptide
GENEID : 5159
HGNC : 8804
MIM : 173410
Vega : OTTHUMG00000130053
Target GenBank: BC032224

 

Reference Sequence Alignment

  

HsCD00074943      ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT
NM_002609.3       ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT
                  ************************************************************

HsCD00074943      CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCCTGGTCGTCACACCCCCGGGGCCA
NM_002609.3       CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCCTGGTCGTCACACCCCCGGGGCCA
                  ************************************************************

HsCD00074943      GAGCTTGTCCTCAATGTCTCCAGCACCTTCGTTCTGACCTGCTCGGGTTCAGCTCCGGTG
NM_002609.3       GAGCTTGTCCTCAATGTCTCCAGCACCTTCGTTCTGACCTGCTCGGGTTCAGCTCCGGTG
                  ************************************************************

HsCD00074943      GTGTGGGAACGGATGTCCCAGGAGCCCCCACAGGAAATGGCCAAGGCCCAGGATGGCACC
NM_002609.3       GTGTGGGAACGGATGTCCCAGGAGCCCCCACAGGAAATGGCCAAGGCCCAGGATGGCACC
                  ************************************************************

HsCD00074943      TTCTCCAGCGTGCTCACACTGACCAACCTCACTGGGCTAGACACGGGAGAATACTTTTGC
NM_002609.3       TTCTCCAGCGTGCTCACACTGACCAACCTCACTGGGCTAGACACGGGAGAATACTTTTGC
                  ************************************************************

HsCD00074943      ACCCACAATGACTCCCGTGGACTGGAGACCGATGAGCGGAAACGGCTCTACATCTTTGTG
NM_002609.3       ACCCACAATGACTCCCGTGGACTGGAGACCGATGAGCGGAAACGGCTCTACATCTTTGTG
                  ************************************************************

HsCD00074943      CCAGATCCCACCGTGGGCTTCCTCCCTAATGATGCCGAGGAACTATTCATCTTTCTCACG
NM_002609.3       CCAGATCCCACCGTGGGCTTCCTCCCTAATGATGCCGAGGAACTATTCATCTTTCTCACG
                  ************************************************************

HsCD00074943      GAAATAACTGAGATCACCATTCCATGCCGAGTAACAGACCCACAGCTGGTGGTGACACTG
NM_002609.3       GAAATAACTGAGATCACCATTCCATGCCGAGTAACAGACCCACAGCTGGTGGTGACACTG
                  ************************************************************

HsCD00074943      CACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTTT
NM_002609.3       CACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTCT
                  ********************************************************** *

HsCD00074943      GGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGAT
NM_002609.3       GGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGAT
                  ************************************************************

HsCD00074943      TCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCA
NM_002609.3       TCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCA
                  ************************************************************

HsCD00074943      GTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAAT
NM_002609.3       GTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAAT
                  ************************************************************

HsCD00074943      GAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCG
NM_002609.3       GAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCG
                  ************************************************************

HsCD00074943      GTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGT
NM_002609.3       GTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGT
                  ************************************************************

HsCD00074943      GCCGAGTTAGAAGACTCGGGGACCTACACCTGCAATGTGACGGAGAGTGTGAATGACCAT
NM_002609.3       GCCGAGTTAGAAGACTCGGGGACCTACACCTGCAATGTGACGGAGAGTGTGAATGACCAT
                  ************************************************************

HsCD00074943      CAGGATGAAAAGGCCATCAACATCACCGTGGTTGAGAGCGGCTACGTGCGGCTCCTGGGA
NM_002609.3       CAGGATGAAAAGGCCATCAACATCACCGTGGTTGAGAGCGGCTACGTGCGGCTCCTGGGA
                  ************************************************************

HsCD00074943      GAGGTGGGCACACTACAATTTGCTGAGCTGCATCGGAGCCGGACACTGCAGGTAGTGTTC
NM_002609.3       GAGGTGGGCACACTACAATTTGCTGAGCTGCATCGGAGCCGGACACTGCAGGTAGTGTTC
                  ************************************************************

HsCD00074943      GAGGCCTACCCACCGCCCACTGTCCTGTGGTTCAAAGACAACCGCACCCTGGGCGACTCC
NM_002609.3       GAGGCCTACCCACCGCCCACTGTCCTGTGGTTCAAAGACAACCGCACCCTGGGCGACTCC
                  ************************************************************

HsCD00074943      AGCGCTGGCGAAATCGCCCTGTCCACGCGCAACGTGTCGGAGACCCGGTATGTGTCAGAG
NM_002609.3       AGCGCTGGCGAAATCGCCCTGTCCACGCGCAACGTGTCGGAGACCCGGTATGTGTCAGAG
                  ************************************************************

HsCD00074943      CTGACACTGGTTCGCGTGAAGGTGGCAGAGGCTGGCCACTACACCATGCGGGCCTTCCAT
NM_002609.3       CTGACACTGGTTCGCGTGAAGGTGGCAGAGGCTGGCCACTACACCATGCGGGCCTTCCAT
                  ************************************************************

HsCD00074943      GAGGATGCTGAGGTCCAGCTCTCCTTCCAGCTACAGATCAATGTCCCTGTCCGAGTGCTG
NM_002609.3       GAGGATGCTGAGGTCCAGCTCTCCTTCCAGCTACAGATCAATGTCCCTGTCCGAGTGCTG
                  ************************************************************

HsCD00074943      GAGCTAAGTGAGAGCCACCCTGACAGTGGGGAACAGACAGTCCGCTGTCGTGGCCGGGGC
NM_002609.3       GAGCTAAGTGAGAGCCACCCTGACAGTGGGGAACAGACAGTCCGCTGTCGTGGCCGGGGC
                  ************************************************************

HsCD00074943      ATGCCCCAGCCGAACATCATCTGGTCTGCCTGCAGAGACCTCAAAAGGTGTCCACGTGAG
NM_002609.3       ATGCCCCAGCCGAACATCATCTGGTCTGCCTGCAGAGACCTCAAAAGGTGTCCACGTGAG
                  ************************************************************

HsCD00074943      CTGCCGCCCACGCTGCTGGGGAACAGTTCCGAAGAGGAGAGCCAGCTGGAGACTAACGTG
NM_002609.3       CTGCCGCCCACGCTGCTGGGGAACAGTTCCGAAGAGGAGAGCCAGCTGGAGACTAACGTG
                  ************************************************************

HsCD00074943      ACGTACTGGGAGGAGGAGCAGGAGTTTGAGGTGGTGAGCACACTGCGTCTGCAGCACGTG
NM_002609.3       ACGTACTGGGAGGAGGAGCAGGAGTTTGAGGTGGTGAGCACACTGCGTCTGCAGCACGTG
                  ************************************************************

HsCD00074943      GATCGGCCACTGTCGGTGCGCTGCACGCTGCGCAACGCTGTGGGCCAGGACACGCAGGAG
NM_002609.3       GATCGGCCACTGTCGGTGCGCTGCACGCTGCGCAACGCTGTGGGCCAGGACACGCAGGAG
                  ************************************************************

HsCD00074943      GTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCC
NM_002609.3       GTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCC
                  ************************************************************

HsCD00074943      CTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCA
NM_002609.3       CTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCA
                  ************************************************************

HsCD00074943      CGTTACGAGATCCGATGGAAGGTGATTGAGTCTGTGAGCTCTGACGGCCATGAGTACATC
NM_002609.3       CGTTACGAGATCCGATGGAAGGTGATTGAGTCTGTGAGCTCTGACGGCCATGAGTACATC
                  ************************************************************

HsCD00074943      TACGTGGACCCCATGCAGCTGCCCTATGACTCCACGTGGGAGCTGCCGCGGGACCAGCTT
NM_002609.3       TACGTGGACCCCATGCAGCTGCCCTATGACTCCACGTGGGAGCTGCCGCGGGACCAGCTT
                  ************************************************************

HsCD00074943      GTGCTGGGACGCACCCTCGGCTCTGGGGCCTTTGGGCAGGTGGTGGGGGCCACGGCTCAT
NM_002609.3       GTGCTGGGACGCACCCTCGGCTCTGGGGCCTTTGGGCAGGTGGTGGAGGCCACGGCTCAT
                  **********************************************.*************

HsCD00074943      GGCCTGAGCCATTCTCAGGCCACGATGAAAGTGGCCGTCAAGATGCTTAAATCCACAGCC
NM_002609.3       GGCCTGAGCCATTCTCAGGCCACGATGAAAGTGGCCGTCAAGATGCTTAAATCCACAGCC
                  ************************************************************

HsCD00074943      CGCAGCAGTGAGAAGCAAGCCCTTATGTCGGAGCTGAAGATCATGAGTCACCTTGGGCCC
NM_002609.3       CGCAGCAGTGAGAAGCAAGCCCTTATGTCGGAGCTGAAGATCATGAGTCACCTTGGGCCC
                  ************************************************************

HsCD00074943      CACCTGAACGTGGTCAACCTGTTGGGGGCCTGCACCAAAGGAGGACCCATCTATATCATC
NM_002609.3       CACCTGAACGTGGTCAACCTGTTGGGGGCCTGCACCAAAGGAGGACCCATCTATATCATC
                  ************************************************************

HsCD00074943      ACTGAGTACTGCCGCTACGGAGACCTGGTGGACTACCTGCACCGCAACAAACACACCTTC
NM_002609.3       ACTGAGTACTGCCGCTACGGAGACCTGGTGGACTACCTGCACCGCAACAAACACACCTTC
                  ************************************************************

HsCD00074943      CTGCAGCACCACTCCGACAAGCGCCGCCCGCCCAGCGCGGAGCTCTACAGCAATGCTCTG
NM_002609.3       CTGCAGCACCACTCCGACAAGCGCCGCCCGCCCAGCGCGGAGCTCTACAGCAATGCTCTG
                  ************************************************************

HsCD00074943      CCCGTTGGGCTCCCCCTGCCCAGCCATGTGTCCTTGACCGGGGAGAGCGACGGTGGCTAC
NM_002609.3       CCCGTTGGGCTCCCCCTGCCCAGCCATGTGTCCTTGACCGGGGAGAGCGACGGTGGCTAC
                  ************************************************************

HsCD00074943      ATGGACATGAGCAAGGACGAGTCGGTGGACTATGTGCCCATGCTGGACATGAAAGGAGAC
NM_002609.3       ATGGACATGAGCAAGGACGAGTCGGTGGACTATGTGCCCATGCTGGACATGAAAGGAGAC
                  ************************************************************

HsCD00074943      GTCAAATATGCAGACATCGAGTCCTCCAACTACATGGCCCCTTACGATAACTACGTTCCC
NM_002609.3       GTCAAATATGCAGACATCGAGTCCTCCAACTACATGGCCCCTTACGATAACTACGTTCCC
                  ************************************************************

HsCD00074943      TCTGCCCCTGAGAGGACCTGCCGAGCAACTTTGATCAACGAGTCTCCAGTGCTAAGCTAC
NM_002609.3       TCTGCCCCTGAGAGGACCTGCCGAGCAACTTTGATCAACGAGTCTCCAGTGCTAAGCTAC
                  ************************************************************

HsCD00074943      ATGGACCTCGTGGGCTTCAGCTACCAGGTGGCCAATGGCATGGAGTTTCTGGCCTCCAAG
NM_002609.3       ATGGACCTCGTGGGCTTCAGCTACCAGGTGGCCAATGGCATGGAGTTTCTGGCCTCCAAG
                  ************************************************************

HsCD00074943      AACTGCGTCCACAGAGACCTGGCGGCTAGGAACGTGCTCATCTGTGAAGGCAAGCTGGTC
NM_002609.3       AACTGCGTCCACAGAGACCTGGCGGCTAGGAACGTGCTCATCTGTGAAGGCAAGCTGGTC
                  ************************************************************

HsCD00074943      AAGATCTGTGACTTTGGCCTGGCTCGAGACATCATGCGGGACTCGAATTACATCTCCAAA
NM_002609.3       AAGATCTGTGACTTTGGCCTGGCTCGAGACATCATGCGGGACTCGAATTACATCTCCAAA
                  ************************************************************

HsCD00074943      GGCAGCACCTTTTTGCCTTTAAAGTGGATGGCTCCGGAGAGCATCTTCAACAGCCTCTAC
NM_002609.3       GGCAGCACCTTTTTGCCTTTAAAGTGGATGGCTCCGGAGAGCATCTTCAACAGCCTCTAC
                  ************************************************************

HsCD00074943      ACCACCCTGAGCGACGTGTGGTCCTTCGGGATCCTGCTCTGGGAGATCTTCACCTTGGGT
NM_002609.3       ACCACCCTGAGCGACGTGTGGTCCTTCGGGATCCTGCTCTGGGAGATCTTCACCTTGGGT
                  ************************************************************

HsCD00074943      GGCACCCCTTACCCAGAGCTGCCCATGAACGAGCAGTTCTACAATGCCATCAAACGGGGT
NM_002609.3       GGCACCCCTTACCCAGAGCTGCCCATGAACGAGCAGTTCTACAATGCCATCAAACGGGGT
                  ************************************************************

HsCD00074943      TACCGCATGGCCCAGCCTGCCCATGCCTCCGACGAGATCTATGAGATCATGCAGAAGTGC
NM_002609.3       TACCGCATGGCCCAGCCTGCCCATGCCTCCGACGAGATCTATGAGATCATGCAGAAGTGC
                  ************************************************************

HsCD00074943      TGGGAAGAGAAGTTTGAGATTCGGCCCCCCTTCTCCCAGCTGGTGCTGCTTCTCGAGAGA
NM_002609.3       TGGGAAGAGAAGTTTGAGATTCGGCCCCCCTTCTCCCAGCTGGTGCTGCTTCTCGAGAGA
                  ************************************************************

HsCD00074943      CTGTTGGGCGAAGGTTACAAAAAGAAGTACCAGCAGGTGGATGAGGAGTTTCTGAGGAGT
NM_002609.3       CTGTTGGGCGAAGGTTACAAAAAGAAGTACCAGCAGGTGGATGAGGAGTTTCTGAGGAGT
                  ************************************************************

HsCD00074943      GACCACCCAGCCATCCTTCGGTCCCAGGCCCGCTTGCCTGGGTTCCATGGCCTCCGATCT
NM_002609.3       GACCACCCAGCCATCCTTCGGTCCCAGGCCCGCTTGCCTGGGTTCCATGGCCTCCGATCT
                  ************************************************************

HsCD00074943      CCCCTGGACACCAGCTCCGTCCTCTATACTGCCGTGCAGCCCAATGAGGGTGACAACGAC
NM_002609.3       CCCCTGGACACCAGCTCCGTCCTCTATACTGCCGTGCAGCCCAATGAGGGTGACAACGAC
                  ************************************************************

HsCD00074943      TATATCATCCCCCTGCCTGACCCCAAACCCGAGGTTGCTGACGAGGGCCCACTGGAGGGT
NM_002609.3       TATATCATCCCCCTGCCTGACCCCAAACCCGAGGTTGCTGACGAGGGCCCACTGGAGGGT
                  ************************************************************

HsCD00074943      TCCCCCAGCCTAGCCAGCTCCACCCTGAATGAAGTCAACACCTCCTCAACCATCTCCTGT
NM_002609.3       TCCCCCAGCCTAGCCAGCTCCACCCTGAATGAAGTCAACACCTCCTCAACCATCTCCTGT
                  ************************************************************

HsCD00074943      GACAGCCCCCTGGAGCCCCAGGACGAACCAGAGCCAGAGCCCCAGCTTGAGCTCCAGGTG
NM_002609.3       GACAGCCCCCTGGAGCCCCAGGACGAACCAGAGCCAGAGCCCCAGCTTGAGCTCCAGGTG
                  ************************************************************

HsCD00074943      GAGCCGGAGCCAGAGCTGGAACAGTTGCCGGATTCGGGGTGCCCTGCGCCTCGGGCGGAA
NM_002609.3       GAGCCGGAGCCAGAGCTGGAACAGTTGCCGGATTCGGGGTGCCCTGCGCCTCGGGCGGAA
                  ************************************************************

HsCD00074943      GCAGAGGATAGCTTCCTGTAG
NM_002609.3       GCAGAGGATAGCTTCCTGTAG
                  *********************

Pathways

NCI : Beta3 integrin cell surface interactions
NCI : Nectin adhesion pathway
NCI : PDGF receptor signaling network
NCI : PDGFR-beta signaling pathway
NCI : S1P1 pathway
NCI : S1P3 pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : Validated targets of C-MYC transcriptional repression
Panther : Angiogenesis
Panther : PDGF signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Focal Adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Osteoblast Signaling
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 217982
HIP Master Clone ID : 95699
Original Clone ID : FLH217982.01X

Organism


TAX_ID : 9606
Species Specific ID: 5159

Genome

Chromosome : 5
Map Location : 5q33.1
Ensembl : ENSG00000113721

Reagents

Labome : PDGFR-beta-antibody