DNASU Plasmid Repository • 480.965.5697 | Email

MAPK3 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  MAPK3
Gene Name:  mitogen-activated protein kinase 3
Original Clone ID: FLH217992.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1140nts         Open reading frame : 1 to 1140
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1151
Start on reference sequence 12
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : MAPK3
Symbol Nomenclature : MAPK3
Designation : MAP kinase isoform p44|MAPK 1|extracellular signal-regulated kinase 1|extracellular signal-related kinase 1|insulin-stimulated MAP2 kinase|microtubule-associated protein 2 kinase
Full Nomenclature : mitogen-activated protein kinase 3
GENEID : 5595
HGNC : 6877
MIM : 601795
Vega : OTTHUMG00000132149
Target GenBank: BC013992


Reference Sequence Alignment


















                    *********************************************************  .

NM_001040056.2      GG----------------------------------------------------------

                            *.: * **..*...*** . *  *  .* *.**.*:**:**.** *.* ***


NCI : ALK1 signaling events
NCI : ATF-2 transcription factor network
NCI : Alpha-synuclein signaling
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Arf6 downstream pathway
NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHB forward signaling
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : IFN-gamma pathway
NCI : IL2-mediated signaling events
NCI : Integrins in angiogenesis
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PDGFR-beta signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Telomerase
NCI : Regulation of cytoplasmic and nuclear SMAD2/3 signaling
NCI : Retinoic acid receptors-mediated signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : S1P1 pathway
NCI : S1P2 pathway
NCI : S1P3 pathway
NCI : S1P4 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-1-mediated signaling events
NCI : Syndecan-2-mediated signaling events
NCI : TRAIL signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : mTOR signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Interferon-gamma signaling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Parkinson disease
Panther : Ras Pathway
Panther : T cell activation
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : VEGF signaling pathway
Reactome : ARMS-mediated activation
Reactome : Activated TLR4 signalling
Reactome : Activation of the AP-1 family of transcription factors
Reactome : Advanced glycosylation endproduct receptor signaling
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Axon guidance
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : ERK activation
Reactome : ERK/MAPK targets
Reactome : ERK1 activation
Reactome : ERKs are inactivated
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Gene Expression
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interferon Signaling
Reactome : Interleukin-2 signaling
Reactome : L1CAM interactions
Reactome : M Phase
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : Platelet activation, signaling and aggregation
Reactome : Prolonged ERK activation events
Reactome : RAF/MAP kinase cascade
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Opening
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signal attenuation
Reactome : Signal transduction by L1
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Spry regulation of FGF signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcription
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : EPO Receptor Signaling
WikiPathway : FSH signaling pathway
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : IL-9 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Osteopontin Signaling
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway


Cloning Information : 217992
HIP Master Clone ID : 111862
Original Clone ID : FLH217992.01X


TAX_ID : 9606
Species Specific ID: 5595


Chromosome : 16
Map Location : 16p11.2
Ensembl : ENSG00000102882


Labome : ERK1-antibody