DNASU Plasmid Repository • 480.965.5697 | Email

HRAS (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HRAS
Gene Name:  Harvey rat sarcoma viral oncogene homolog
Sequence             
Original Clone ID: FLH213057.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00075099

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 570nts         Open reading frame : 1 to 570
Reference Sequence Alignment

ATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACC
ATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTAC
CGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGC
CAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGT
GTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATC
AAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTG
GCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCC
TACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTG
CGTGAGATCCGGCAGCACAAGCTGCGGAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGC
TGCATGAGCTGCAAGTGTGTGCTCTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 570
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HRAS
Symbol Nomenclature : HRAS
SYNONYM : C-BAS/HAS; C-H-RAS; C-HA-RAS1; CTLO; H-RASIDX; HAMSV; HRAS1; K-RAS; N-RAS; RASH1
Designation : GTP- and GDP-binding peptide B|GTPase HRas|H-Ras-1|Ha-Ras1 proto-oncoprotein|Ras family small GTP binding protein H-Ras|c-has/bas p21 protein|c-ras-Ki-2 activated oncogene|p19 H-RasIDX protein|p21ras|transformation gene: oncogene HAMSV|transforming protein p21|v-Ha-ras Harvey rat sarcoma viral oncogene homolog
Full Nomenclature : Harvey rat sarcoma viral oncogene homolog
GENEID : 3265
HGNC : 5173
MIM : 190020
Vega : OTTHUMG00000131919
Target GenBank: NM_005343

 

Reference Sequence Alignment

  

HsCD00075099        ATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACC
NM_005343.2         ATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACC
NM_001130442.1      ATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACC
                    ************************************************************

HsCD00075099        ATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTAC
NM_005343.2         ATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTAC
NM_001130442.1      ATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTAC
                    ************************************************************

HsCD00075099        CGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGC
NM_005343.2         CGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGC
NM_001130442.1      CGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGC
                    ************************************************************

HsCD00075099        CAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGT
NM_005343.2         CAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGT
NM_001130442.1      CAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGT
                    ************************************************************

HsCD00075099        GTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATC
NM_005343.2         GTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATC
NM_001130442.1      GTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATC
                    ************************************************************

HsCD00075099        AAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTG
NM_005343.2         AAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTG
NM_001130442.1      AAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTG
                    ************************************************************

HsCD00075099        GCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCC
NM_005343.2         GCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCC
NM_001130442.1      GCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCC
                    ************************************************************

HsCD00075099        TACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTG
NM_005343.2         TACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTG
NM_001130442.1      TACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTG
                    ************************************************************

HsCD00075099        CGTGAGATCCGGCAGCACAAGCTGCGGAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGC
NM_005343.2         CGTGAGATCCGGCAGCACAAGCTGCGGAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGC
NM_001130442.1      CGTGAGATCCGGCAGCACAAGCTGCGGAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGC
                    ************************************************************

HsCD00075099        TGCATGAGCTGCAAGTGTGTGCTCTCCTAG
NM_005343.2         TGCATGAGCTGCAAGTGTGTGCTCTCCTGA
NM_001130442.1      TGCATGAGCTGCAAGTGTGTGCTCTCCTGA
                    ****************************..

Pathways

NCI : BCR signaling pathway
NCI : C-MYB transcription factor network
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Downstream signaling in naïve CD8+ T cells
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EGFR-dependent Endothelin signaling events
NCI : EPHB forward signaling
NCI : EPO signaling pathway
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IGF1 pathway
NCI : IL2-mediated signaling events
NCI : Insulin Pathway
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Ras family activation
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-2-mediated signaling events
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
Panther : Angiogenesis
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : TGF-beta signaling pathway
Panther : VEGF signaling pathway
Panther : p53 pathway feedback loops 2
Reactome : ARMS-mediated activation
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Activation of RAS in B cells
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cell surface interactions at the vascular wall
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : MEK activation
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : Ras activation uopn Ca2+ infux through NMDA receptor
Reactome : SHC-mediated cascade
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Tie2 Signaling
Reactome : Transmission across Chemical Synapses
Reactome : p38MAPK events
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : ErbB signaling pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 213057
HIP Master Clone ID : 11244
Original Clone ID : FLH213057.01X

Organism


TAX_ID : 9606
Species Specific ID: 3265

Genome

Chromosome : 11
Map Location : 11p15.5
Ensembl : ENSG00000174775

Reagents

Labome : H-Ras-antibody