DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information


Explanation of Terms

Gene: Gene Symbol: 
Gene Name:  None
Original Clone ID: anti-ATF1-RAB-T55
Keyword: recombinant antibody fab fragment; rAB expression protocol URL: http://recombinant-antibodies.org/protocols/rh22-avi; Sequencing primer heavy chain: GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC/CAGGAAACAGCTATGACCGCGACAGAATCAAGTTTGCC
Species: Homo sapiens
Type: cDNA
Vector Name: RH2.2-Avi               Format:  CLOSED
Source: Recombinant Antibody Network
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: The University of Chicago
Recombinant Antibody Network

Price:  Login for Pricing
No restriction
Special MTA: SPTA


Insert sequence: 738nts        
Open reading frame : 1 to 738


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: 
5' Linker Sequence: None
3' Linker Sequence: None


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Expressed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: RH2.2-Avi

RH2.2-Avi in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  Unknown
Reverse:  Unknown
Description: Vector Description
Comments: None
Size (bp): 0
Parent Vector: None
Empty Vector: None
Properties: ''
Author Name:
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available


Vector Features:

Type Name Description Start Position End Position


  • Clone


Cloning Information : 775849
Original Clone ID : anti-ATF1-RAB-T55