Detailed Plasmid Information

Explanation of Terms

Gene Symbol: 
Gene Name:  None
Original Clone ID:
recombinant antibody fab fragment; rAB expression protocol URL:; Sequencing primer heavy chain: GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC/CAGGAAACAGCTATGACCGCGACAGAATCAAGTTTGCC
Homo sapiens
Vector Name:
Recombinant Antibody Network
Mutation / Discrepancy:
No / No
The University of Chicago
Recombinant Antibody Network
Login for Pricing
No restriction
Special MTA: SPTA
Insert sequence: 720nts
Open reading frame: 1 to 720


Protein sequence predicted based on nucleotide sequence


Coding Sequence Details

Insert Sequence Verified?:
Verification Method:
5' Linker Sequence:
3' Linker Sequence:

Recommended Growth Condition:

Distributed in bacterial strain:
DH5-alpha T1 phage resistant
Antibiotic Selection:
Bacterial Selection Condition: 100 ug/mL ampicillin
Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments: Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results:
ProteinExpressed: Protein_Expressed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Recommended expression in:
Not Applicable