DNASU Plasmid Repository • 480.965.5697 | Email

ACTB (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ACTB
Gene Name:  actin, beta
Sequence             
Original Clone ID: FLH251753.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00075328

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1128nts         Open reading frame : 1 to 1128
Reference Sequence Alignment

ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGC
TTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCAC
CAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGC
AAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGAC
GACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAG
CACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTA
TCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACC
CACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTG
GCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTC
ACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCC
CTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTAC
GAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCA
CTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAAC
TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCT
GGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTG
GCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGG
ATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
GAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1189
Start on reference sequence 62
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ACTB
Symbol Nomenclature : ACTB
SYNONYM : BRWS1; PS1TP5BP1
Designation : PS1TP5-binding protein 1|actin, cytoplasmic 1|beta cytoskeletal actin
Full Nomenclature : actin, beta
GENEID : 60
HGNC : 132
MIM : 102630
Vega : OTTHUMG00000023268
Target GenBank: BC004251

 

Reference Sequence Alignment

  

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ATGGTGGTTGAGGTTGATTCCATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGGTCTC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ATGGTAGCTGAGGTTGATTCAATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGTTCTC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ATGGTAGCTGAGGTTGATTCAATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGTTCTC
NM_001083538.1      ATGGTGGTTGAGGTTGATTCCATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGGTCTC
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AGGAGCAAGATGGGCAAGTGGTGCTGCCGTTGCTTCCCCTGCTGCAGGGAGAGCGGCAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AGGAGCAAGATGGGCAAGTGGTGCCGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AGGAGCAAGATGGGCAAGTGGTGCCGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAG
NM_001083538.1      AGGAGCAAGATGGGCAAGTGGTGCTGCCGTTGCTTCCCCTGCTACAGGGAGAGCGGCAAG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AGCAACGTGGGCACTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAGCAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AGCAACGTGGGCACTTCTGGAGACCAGGACGACTCCACTATGAAGACACTCAGGAGCAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AGCAACGTGGGCACTTCTGGAGACCAGGACGACTCCACTATGAAGACACTCAGGAGCAAG
NM_001083538.1      AGCAACGTGGGCACTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAGCAAG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ATGGGCAAGTGGTGCCGCCACTGCTTCCCCTGCTGCAGGGGGAGTGGCAAGAGCAACGTG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ATGGGCAAGTGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGTGGCAAGAGCAACGTG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ATGGGCAAGTG-------------------------------------------------
NM_001083538.1      ATGGGCAAGTGGTGCCACCACTGCTTCCCCTGCTGCAGGGGGAGTGGCAAGAGCAACGTG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GGCGCTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAACAAGATGGGCAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GGCACTTCTGGAGACCACGACGACTCCGCTATGAAGACGCTCAGGAGCAAGATGGGCAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ------------------------------------------------------------
NM_001083538.1      GGCGCTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAACAAGATGGGGAAG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCAGCAAGAGCAAGGTGGGCGCTTGG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAGAGCAACGTGGGTGCTTGG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      --GTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAGAGCAACGTGGGTGCTTGG
NM_001083538.1      TGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAGAGCAAGGTGGGCGCTTGG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GGAGACTACGATGACAGTGCCTTCATGGAGCCCAGGTACCACGTCCGTGGAGAAGATCTG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GGAGACTACGACGACAGCGCCTTCGTGGAGCCGAGATACCACGTCCGTCGAGAAGATCTG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GGAGACTACGACGACAGCGCCTTCGTGGAGCCGAGATACCACGTCCGTCGAGAAGATCTG
NM_001083538.1      GGAGACTACGATGACAGCGCCTTCATGGAGCCCAGGTACCACGTCCGTGGAGAAGATCTG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCCCCAGAAAGGATCTCATCGTCATG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCGCCAGAAAGGATCTGATCGTCATG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCGCCAGAAAGGATCTGATCGTCATG
NM_001083538.1      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCCCCAGAAAGGATCTCATCGTCATG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CTCAGGGACACTGACGTGAACAAGCAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CTCAGGGACACTGACGTGAACAAGCAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CTCAGGGACACTGACGTGAACAAGCAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
NM_001083538.1      CTCAGGGACACTGACGTGAACAAGAAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TCTGCCAATGGGAATTCAGAAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TCTGCCAATGGGAATTCAGGAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TCTGCCAATGGGAATTCAGGAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
NM_001083538.1      TCTGCCAATGGGAATTCAGAAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GTCCTTGACAACAAAAAGAGGACAGCTCTGATAAAGGCCGTACAATGCCAGGAAGATGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GTCCTTGACAACAAAAAGAGGACAGCTCTGACAAAGGCCGTACAATGCCAGGAAGATGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GTCCTTGACAACAAAAAGAGGACAGCTCTGACAAAGGCCGTACAATGCCAGGAAGATGAA
NM_001083538.1      GTCCTTGACAACAAAAAGAGGACAGCTCTGATAAAGGCCGTACAATGCCAGGAAGATGAA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAATATTCCAGATGAGTATGGAAAT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAACATTCCAGATGAGTATGGAAAT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAACATTCCAGATGAGTATGGAAAT
NM_001083538.1      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAATATTCCAGATGAGTATGGAAAT
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ACCACTCTGCACTACGCTATCTATAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ACCACTCTACACTACGCTATCTACAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ACCACTCTACACTACGCTATCTACAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
NM_001083538.1      ACCACTCTGCACTACGCTATCTATAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TATGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGTTACTTGGTGTA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TACGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGCTACTTGGTGTA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TACGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGCTACTTGGTGTA
NM_001083538.1      TATGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGTTACTTGGTGTA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CATGAGCAAAAACAGCAAGTCGTGAAATTTTTAATTAAGAAAAAAGCGAATTTAAATGCA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CATGAGCAAAAACAGCAAGTGGTGAAATTTTTAATCAAGAAAAAAGCGAATTTAAATGCG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CATGAGCAAAAACAGCAAGTGGTGAAATTTTTAATCAAGAAAAAAGCGAATTTAAATGCA
NM_001083538.1      CATGAGCAAAAACAGCAAGTCGTGAAATTTTTAATCAAGAAAAAAGCGAATTTAAATGCA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CTGGATAGATATGGAAGAACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CTGGATAGATATGGAAGAACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CTGGATAGATATGGAAGAACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
NM_001083538.1      CTGGATAGATATGGAAGGACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
NM_001083538.1      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
NM_001083538.1      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGACTTAAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGACTTAAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGACTTAAAG
NM_001083538.1      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGAGTTAAAG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
NM_001083538.1      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ATGTCTCAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ATGTCTCAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ATGTCTCAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
NM_001083538.1      ATGTCTCAAGAACTAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGACTAATGGTGTCACTGCTGGC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGAGTAATGGTGTCACTGCTGGC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGAGTAATGGTGTCACTGCTGGC
NM_001083538.1      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGACTAATGGTGTCACTGCTGGC
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AATGGTGATAATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AATGGTGATGATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AATGGTGATGATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
NM_001083538.1      AATGGTGATAATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGTGAATTACTTTCTGACTACAAAGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGCGAATTAGTTTCTGACTACAAAGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGCGAATTAGTTTCTGACTACAAAGAA
NM_001083538.1      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGTGAATTACTTTCTGACTACAAAGAA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAGCAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAACAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAACAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
NM_001083538.1      AAGCAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
NM_001083538.1      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
NM_001083538.1      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAATGAAGAAGCACAGAAGTACTCATGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAATGAAGAAGCACGGAAGTACTCACGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAAATGAAGAAGCACGGAAGTACTCACGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
NM_001083538.1      GAAATGAAGAAGCACGGAAGTACTCATGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
NM_001083538.1      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
NM_001083538.1      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
NM_001083538.1      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
NM_001083538.1      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAAAAGACATCTTGCATGAAAATAGTACGTTGCGGGAAGAAATTGCCATGCTAAGACTG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAAAAGACTTCTTGCATGAAAATAGTACGTTGCGGGAAGAAATTGCCATGCTAAGACTG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAAAGAGACTTCTTGCATGAAAATAGTATGTTGCGGGAAGAAATTGCCATGCTAAGACTG
NM_001083538.1      GAAAAAGACGTCTTGCATGAAAATAGTACGTTGCGGGAAGAAATTGCCATGCTAAGACTG
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAGAAAAGAAATATTTGGAGGATATT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAAAAAAGAAATATTTGGAGGATATT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAAAAAAGAAATATTTGGAGGATATT
NM_001083538.1      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAGAAAAGAAATATTTGGAGGATATT
                                                                                

HsCD00075328        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------ATGTGT
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAAGTGTGAAAAAAAGGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAAGTGTGAAAAAAAAGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
NM_001615.3         ---------------------------------------------------------ATG
NM_001141945.1      ------------------------------------------------------ATGTGT
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ---------------------------------------------------------ATG
NM_001100.3         ------------------------------------------------------ATGTGC
NM_001613.2         ------------------------------------------------------ATGTGT
NM_001277083.1      GAAAGTGTGAAAAAAAAGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
NM_001083538.1      GAAAGTGTGAAAAAAAAGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
                                                                                

HsCD00075328        ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGC
NM_005159.4         GACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAGGCCGGC
NM_001199954.1      ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGT
NM_001099771.2      ATGGATGATGATACCGCTGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
NM_001101.3         ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGC
NM_001277406.1      ATGGATGATGATACCGCCGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
NM_001615.3         TGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCAGGC
NM_001141945.1      GAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGC
NM_001614.3         ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGT
NM_001017992.3      ACTGACAATGAGCTGTCTGCCTTGGTAGTGGATAATGGGTCAGGGATGTGCAAGGCAGGC
NM_001100.3         GACGAAGACGAGACCACCGCCCTCGTGTGCGACAATGGCTCCGGCCTGGTGAAAGCCGGC
NM_001613.2         GAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGC
NM_001277083.1      ATGGATGATGATACCGCTGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
NM_001083538.1      ATGGATGATGATACCGCCGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
                       ** .* ** .   * *   * **    ** ** ** ** ** .*    **.** ** 

HsCD00075328        TTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCAC
NM_005159.4         TTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCGCGGCAC
NM_001199954.1      TTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACAC
NM_001099771.2      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGCGCCCCAGGCAG
NM_001101.3         TTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCAC
NM_001277406.1      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGCGCCCCAGGCAG
NM_001615.3         TTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGCCAC
NM_001141945.1      TTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACAT
NM_001614.3         TTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACAC
NM_001017992.3      TTTGGTGGTGACGATGCCCCCCGGGCTGTGTTCCCCTCCATGATAGGGCGTCCTCGACAC
NM_001100.3         TTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCCATCGTGGGCCGCCCCCGACAC
NM_001613.2         TTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACAT
NM_001277083.1      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGTGCCCCAGGCAG
NM_001083538.1      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGCGCCCCAGGCAG
                    ** *  ** ** ** ** ** .* ** ** ** ** ***** .* **  * ** .* ** 

HsCD00075328        CAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGC
NM_005159.4         CAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCCCAGAGC
NM_001199954.1      CAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGC
NM_001099771.2      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
NM_001101.3         CAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGC
NM_001277406.1      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
NM_001615.3         CAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCTCAGAGC
NM_001141945.1      CAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGC
NM_001614.3         CAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGC
NM_001017992.3      CAGGGCGTTATGGTAGGCATGGGCCAGAAGGACTGCTACGTGGGAGATGAGGCTCAGAGC
NM_001100.3         CAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACGAGGCTCAGAGC
NM_001613.2         CAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGC
NM_001277083.1      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
NM_001083538.1      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
                    ***** .* ****  ** *** . **.**.** : *** **.** .* **.** ******

HsCD00075328        AAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGAC
NM_005159.4         AAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCAACTGGGAC
NM_001199954.1      AAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGAC
NM_001099771.2      AAAAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
NM_001101.3         AAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGAC
NM_001277406.1      AAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
NM_001615.3         AAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAACTGGGAT
NM_001141945.1      AAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGAC
NM_001614.3         AAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGAC
NM_001017992.3      AAGAGAGGCGTCCTGACCCTGAAGTATCCTATCGAGCATGGAGTGGTCACCAACTGGGAC
NM_001100.3         AAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGAT
NM_001613.2         AAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGAC
NM_001277083.1      AAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
NM_001083538.1      AAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
                    **..*:** .**** ** ** **.** ** ** **.** ** .* .************* 

HsCD00075328        GACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAG
NM_005159.4         GACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTCCGTGTGGCTCCCGAGGAG
NM_001199954.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAG
NM_001099771.2      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCTCCCGAGGAG
NM_001101.3         GACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAG
NM_001277406.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCTGAGGAG
NM_001615.3         GACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCTGAAGAG
NM_001141945.1      GACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAG
NM_001614.3         GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAG
NM_001017992.3      GATATGGAAAAGATCTGGTACCACACATTCTACAATGAGCTCCGTGTGGCACCAGATGAG
NM_001100.3         GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAG
NM_001613.2         GACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAG
NM_001277083.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCCGAGGAG
NM_001083538.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCTCCCGAGGAG
                    ** *****.**.****** *****:* ******** ***** ** ** ** ** ** ***

HsCD00075328        CACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_005159.4         CACCCCACCCTGCTCACAGAGGCCCCGCTGAACCCCAAGGCCAACCGGGAGAAGATGACT
NM_001199954.1      CACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACT
NM_001099771.2      CACCCCGTCCTGCTGACCGAGGCCACCCTGAACCCTAAGGCCAACCGCGAGAAGATGACC
NM_001101.3         CACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_001277406.1      CACCCCATCCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_001615.3         CACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAAAAGATGACC
NM_001141945.1      CATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACT
NM_001614.3         CACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACT
NM_001017992.3      CATCCCATCCTCCTCACCGAGGCACCCCTGAACCCCAAGATCAACCGGGAAAAGATGACT
NM_001100.3         CACCCCACCCTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACC
NM_001613.2         CATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACT
NM_001277083.1      CACCCCATCCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_001083538.1      CACCCCATCCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
                    ** **..  ** ** ** ***** .* ** ** ** ***. ****.* **.**.***** 

HsCD00075328        CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTA
NM_005159.4         CAGATCATGTTTGAGACCTTCAATGTCCCTGCCATGTACGTGGCCATCCAGGCAGTGCTA
NM_001199954.1      CAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_001099771.2      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCTGTGCTG
NM_001101.3         CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTA
NM_001277406.1      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCCATGCTG
NM_001615.3         CAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCTGTGCTC
NM_001141945.1      CAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTG
NM_001614.3         CAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_001017992.3      CAGATCATGTTCGAGGCTTTCAACACACCAGCCATGTATGTCGCCATCCAGGCTGTGCTG
NM_001100.3         CAGATCATGTTTGAGACCTTCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_001613.2         CAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTG
NM_001277083.1      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCCATGCTG
NM_001083538.1      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCCGTGCCG
                    **.** ***** **..* ***** .  ** ******** ** ** ** **.** .***  

HsCD00075328        TCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACC
NM_005159.4         TCCCTGTATGCTTCTGGCCGTACCACAGGCATTGTTCTGGACTCTGGGGATGGTGTAACT
NM_001199954.1      TCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACC
NM_001099771.2      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
NM_001101.3         TCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACC
NM_001277406.1      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
NM_001615.3         TCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGTCACC
NM_001141945.1      TCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACC
NM_001614.3         TCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACC
NM_001017992.3      TCCCTCTATGCCTCAGGACGGACCACAGGCATCGTGATGGATTCTGGGGATGGGGTCACT
NM_001100.3         TCCCTCTACGCCTCCGGCAGGACCACCGGCATCGTGCTGGACTCCGGCGACGGCGTCACC
NM_001613.2         TCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACC
NM_001277083.1      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
NM_001083538.1      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
                    ** ** ** .* ** ** .* ** ** ***** ** .**** ** ** ** ** **.** 

HsCD00075328        CACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTG
NM_005159.4         CACAATGTCCCCATCTATGAGGGCTACGCTTTGCCCCATGCCATCATGCGTCTGGATCTG
NM_001199954.1      CACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTG
NM_001099771.2      CACACTGTGCCCATCTATGAGGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
NM_001101.3         CACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTG
NM_001277406.1      CACACTGTGCCCATCTATGATGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
NM_001615.3         CACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTG
NM_001141945.1      CACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTG
NM_001614.3         CACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTG
NM_001017992.3      CACATCGTGCCCATCTATGAAGGTTATGCCCTGCCTCATGCCATTCTACGCCTGGATCTG
NM_001100.3         CACAACGTGCCCATTTATGAGGGCTACGCGCTGCCGCACGCCATCATGCGCCTGGACCTG
NM_001613.2         CACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTG
NM_001277083.1      CACACTGTGCCCATCTATGATGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
NM_001083538.1      CACACTGTGCCCATCTATGAGGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
                    ****  ** ***** ** ** ** :* **  * ** ** ****  .*.** **.**  **

HsCD00075328        GCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTC
NM_005159.4         GCTGGTCGGGACCTCACTGACTACCTCATGAAGATCCTCACTGAGCGTGGCTACTCCTTT
NM_001199954.1      GCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTC
NM_001099771.2      GCTGGGCGGGAACTGCCTGACTACCTCATGAAGATCCTCACCGAGCATGGCTATAGGTTC
NM_001101.3         GCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTC
NM_001277406.1      GCTGGGCGGGAACTGACTGACTACCTCATGAAGATCCTCACCGAGCGTGGCTATAGGTTC
NM_001615.3         GCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTT
NM_001141945.1      GCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTC
NM_001614.3         GCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTC
NM_001017992.3      GCAGGGAGAGACCTGACTGATTACCTCATGAAGATCCTGACAGAGCGAGGCTATAACTTC
NM_001100.3         GCGGGCCGCGATCTCACCGACTACCTGATGAAGATCCTCACTGAGCGTGGCTACTCCTTC
NM_001613.2         GCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTC
NM_001277083.1      GCTGGGCGGGAACTGACTGACTACCTCATGAAGATCCTCACCGAGCGTGGCTATAGGTTC
NM_001083538.1      GCTGGGCGGGAACTGCCTGACTACCTCATGAAGATCCTCACCGAGCGTGGCTATAGGTTC
                    ** ** .* ** ** .* ** ***** *********** ** ***.. ***** :  ** 

HsCD00075328        ACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCC
NM_005159.4         GTCACCACTGCTGAACGTGAAATTGTCCGTGACATTAAAGAGAAGCTGTGCTATGTCGCC
NM_001199954.1      ACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCC
NM_001099771.2      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
NM_001101.3         ACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCC
NM_001277406.1      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
NM_001615.3         GTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCC
NM_001141945.1      GTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCT
NM_001614.3         ACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCC
NM_001017992.3      ACCACCACTGCTGAGCGGGAGATTGTGCGAGATGTCAAAGAGAAGCTGTGCTACGTAGCC
NM_001100.3         GTGACCACAGCTGAGCGCGAGATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTGGCC
NM_001613.2         GTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCT
NM_001277083.1      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
NM_001083538.1      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
                    .  ** *  ** **..* **.** ** ** ** .* **.*****.***** ** ** ** 

HsCD00075328        CTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTAC
NM_005159.4         CTGGATTTTGAGAATGAGATGGCCACAGCTGCCTCTTCCTCCTCCCTGGAGAAGAGCTAT
NM_001199954.1      CTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTAC
NM_001099771.2      CTGGACTTCGAGCAGGAGATGGCCACGGTGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
NM_001101.3         CTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTAC
NM_001277406.1      CTGGACTTCGAGCAGGAGATGGCCATGGCGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
NM_001615.3         CTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTAT
NM_001141945.1      CTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTAC
NM_001614.3         CTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTAC
NM_001017992.3      CTGGACTTTGAGCAGGAGATGGTCAGGGCAGCCGCATCCTCCTCACCGGAACGGAGCTAT
NM_001100.3         CTGGACTTCGAGAACGAGATGGCGACGGCCGCCTCCTCCTCCTCCCTGGAAAAGAGCTAC
NM_001613.2         CTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTAC
NM_001277083.1      CTGGACTTCGAGCAGGAGATGGCCATGGTGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
NM_001083538.1      CTGGACTTCGAGCAGGAGATGGCCACGGCGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
                    ***** ** **..* *******  *  *  **  * :  ** ** *  **...*** ** 

HsCD00075328        GAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCA
NM_005159.4         GAACTGCCTGATGGCCAAGTCATCACTATTGGCAATGAGCGCTTCCGCTGTCCTGAGACA
NM_001199954.1      GAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCG
NM_001099771.2      GAGCTGCCCGATGGCCAGGTCATCACCATCGGCAACGAGCGGTTCCGCTGCCCCGAGGCG
NM_001101.3         GAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCA
NM_001277406.1      GAGCTGCCCGATGGCCAGGTCATCACCATCGGCAACGAGTGGTTCCGCTGCCCCGAGGCG
NM_001615.3         GAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCTGAGACC
NM_001141945.1      GAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACC
NM_001614.3         GAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCG
NM_001017992.3      GAACTTCCTGATGGGCAGGTGATCACCATTGGGAATGAACGCTTCCGATGCCCTGAAGCC
NM_001100.3         GAGCTGCCAGACGGGCAGGTCATCACCATCGGCAACGAGCGCTTCCGCTGCCCGGAGACG
NM_001613.2         GAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACC
NM_001277083.1      GAGCTGCCCGATGGCCAGGTCATCACCATCAGCAACGAGTGGTTCCGCTGCCCCGAGGCG
NM_001083538.1      GAGCTGCCCGATGGCCAGGTCATCACCATCGGCAACGAGCGGTTCCGCTGCCCCGAGGCG
                    **. * ** ** ** **.** ***** ** .* ** **. * ***** ** ** **..* 

HsCD00075328        CTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAAC
NM_005159.4         CTCTTCCAGCCCTCCTTCATTGGTATGGAATCTGCTGGCATCCATGAAACAACTTACAAT
NM_001199954.1      CTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAAC
NM_001099771.2      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
NM_001101.3         CTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAAC
NM_001277406.1      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
NM_001615.3         CTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACCTACAAT
NM_001141945.1      CTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAAC
NM_001614.3         CTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAAC
NM_001017992.3      ATTTTCCAGCCTTCCTTTCTGGGCATTGAGTCCAGTGGGATCCATGAGACAACCTTCAAC
NM_001100.3         CTCTTCCAGCCCTCCTTCATCGGTATGGAGTCGGCGGGCATTCACGAGACCACCTACAAC
NM_001613.2         CTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAAC
NM_001277083.1      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
NM_001083538.1      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
                    .* ******** * *** .* ** ** **.**    ** ** ** **.** ** *:*** 

HsCD00075328        TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCT
NM_005159.4         AGCATCATGAAGTGTGACATTGATATCCGCAAGGACCTGTATGCCAACAATGTCTTATCT
NM_001199954.1      TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCG
NM_001099771.2      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
NM_001101.3         TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCT
NM_001277406.1      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
NM_001615.3         TCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCTCTCT
NM_001141945.1      AGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCA
NM_001614.3         TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCG
NM_001017992.3      TCTATCATGAAGTGCGATGTGGATATTCGCAAGGATCTCTATGCCAACACCGTGTTATCT
NM_001100.3         AGCATCATGAAGTGTGACATCGACATCAGGAAGGACCTGTATGCCAACAACGTCATGTCG
NM_001613.2         AGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCA
NM_001277083.1      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
NM_001083538.1      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
                    :  **********  ** .* ** ** .* **.**  * ** .* ****. **  * ** 

HsCD00075328        GGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTG
NM_005159.4         GGAGGCACCACTATGTACCCTGGTATTGCTGATCGTATGCAGAAGGAAATCACTGCTCTG
NM_001199954.1      GGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTG
NM_001099771.2      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
NM_001101.3         GGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTG
NM_001277406.1      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
NM_001615.3         GGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTG
NM_001141945.1      GGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTA
NM_001614.3         GGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTG
NM_001017992.3      GGAGGGAGCACCATGTACCCAGGCATTGCTGACAGGATGCAGAAAGAAATCATAACCCTG
NM_001100.3         GGGGGCACCACGATGTACCCTGGGATCGCTGACCGCATGCAGAAAGAGATCACCGCGCTG
NM_001613.2         GGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTA
NM_001277083.1      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
NM_001083538.1      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
                    ** ** * *** ******** ** ** **  * .* ********.**.***.  .* **.

HsCD00075328        GCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGG
NM_005159.4         GCTCCTAGCACCATGAAGATTAAGATTATTGCTCCCCCTGAGCGTAAATACTCTGTCTGG
NM_001199954.1      GCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGG
NM_001099771.2      GCGCCTAGCATGATGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
NM_001101.3         GCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGG
NM_001277406.1      GCGCCTAGCATGTTGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
NM_001615.3         GCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTCTGG
NM_001141945.1      GCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGG
NM_001614.3         GCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGG
NM_001017992.3      GCACCCAGCACCATGAAAATCAAGATCATAGCTCCCCCAGAGCGGAAGTATTCTGTTTGG
NM_001100.3         GCACCCAGCACCATGAAGATCAAGATCATCGCCCCGCCGGAGCGCAAATACTCGGTGTGG
NM_001613.2         GCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGG
NM_001277083.1      GCGCCTAGCATGATGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
NM_001083538.1      GCGCCTAGCATGATGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
                    ** ** ****  :****.** *.*** ** ** ** ** .**** **.** ** ** ***

HsCD00075328        ATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_005159.4         ATTGGGGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAAATGTGGATTAGCAAGCAA
NM_001199954.1      ATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAG
NM_001099771.2      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001101.3         ATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001277406.1      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001615.3         ATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAAGCCT
NM_001141945.1      ATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAG
NM_001614.3         ATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAG
NM_001017992.3      ATTGGGGGCTCCATCCTTGCCAGCCTGTCCACATTCCAGCAGATGTGGATCAGTAAGCAG
NM_001100.3         ATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCACCAAGCAG
NM_001613.2         ATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAG
NM_001277083.1      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001083538.1      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
                    .* ** ***** ***** ***:  ** *****.********.******** *  **.*. 

HsCD00075328        GAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG
NM_005159.4         GAGTACGATGAGGCAGGCCCATCCATTGTCCACCGCAAATGCTTCTAA
NM_001199954.1      GAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
NM_001099771.2      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTGTAG
NM_001101.3         GAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG
NM_001277406.1      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTCTAG
NM_001615.3         GAGTATGATGAGGCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTAA
NM_001141945.1      GAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAA
NM_001614.3         GAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
NM_001017992.3      GAATATGATGAGGCTGGTCCTCCTATCGTTCACAGAAAATGTTTCTGA
NM_001100.3         GAGTACGACGAGGCCGGCCCTTCCATCGTCCACCGCAAATGCTTCTAG
NM_001613.2         GAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAA
NM_001277083.1      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTCTAG
NM_001083538.1      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTCTAG
                    **.** ** **. * ** **  * ** ** ***.* **.** ** *..

Pathways

Panther : Alzheimer disease-presenilin pathway
Panther : Cadherin signaling pathway
Panther : Cytoskeletal regulation by Rho GTPase
Panther : Huntington disease
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Reactome : Chaperonin-mediated protein folding
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : Folding of actin by CCT/TriC
Reactome : Gene Expression
Reactome : HATs acetylate histones
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin-like Growth Factor-2 mRNA Binding Proteins (IGF2BPs/IMPs/VICKZs) bind RNA
Reactome : Metabolism of proteins
Reactome : Prefoldin mediated transfer of substrate to CCT/TriC
Reactome : Protein folding
Reactome : Regulation of actin dynamics for phagocytic cup formation
WikiPathway : Focal Adhesion
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Regulation of Actin Cytoskeleton

Protein

SMART domain : ACTIN : Actin
UniProt : Q1KLZ0
UniProt : P60709
HPRD : 00032

Clone

Cloning Information : 251753
HIP Master Clone ID : 92531
Original Clone ID : FLH251753.01X

Organism


TAX_ID : 9606
Species Specific ID: 60

Genome

Chromosome : 7
Map Location : 7p22
Ensembl : ENSG00000075624

Reagents

Labome : beta-actin-antibody