DNASU Plasmid Repository • 480.965.5697 | Email

EIF3S2 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF3I
Gene Name:  eukaryotic translation initiation factor 3, subunit I
Sequence             
Original Clone ID: FLH252258.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00075599

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 978nts         Open reading frame : 1 to 978
Reference Sequence Alignment

ATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGATTAAGTATAACCGC
GAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATGTATGGTACTCTGTG
AATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGTGGTGTGTGGACGCT
GACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCTGTCGTCTCTGGGAC
TGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTGTCCGGACCTGCGGT
TTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGATGGGCTACCAGTGC
TTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACAATGAGCCCTACATG
AAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGACCCCTGGGGGAGTGC
ATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCAAGTCTGGAGAGGTG
TTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGTTATCCAGGGACATG
ACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTGACTCCACAACTCTT
GAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTGCCCTCTCCCCCAAC
TATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAACCACAACCTCCACC
AGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAGAAGAGTTTGGAAGA
GTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTGATGGCAAGAGCTAC
AGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACCCACAGTACTTTGAA
TTTGAGTTTGAGGCTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 995
Start on reference sequence 18
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF3I
Symbol Nomenclature : EIF3I
SYNONYM : EIF3S2; PRO2242; TRIP-1; TRIP1; eIF3-beta; eIF3-p36
Designation : TGF-beta receptor-interacting protein 1|TGFbeta receptor-interacting protein 1|eIF-3-beta|eIF3 p36|eukaryotic translation initiation factor 3 subunit 2|eukaryotic translation initiation factor 3 subunit I|eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD)|eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa|predicted protein of HQ2242
Full Nomenclature : eukaryotic translation initiation factor 3, subunit I
GENEID : 8668
Locus Tag : RP4-675E8.1
HGNC : 3272
MIM : 603911
Vega : OTTHUMG00000007364
Target GenBank: NM_003757

 

Reference Sequence Alignment

  

HsCD00075599      ATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGATTAAGTATAACCGC
NM_003757.2       ATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGATTAAGTATAACCGC
                  ************************************************************

HsCD00075599      GAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATGTATGGTACTCTGTG
NM_003757.2       GAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATGTATGGTACTCTGTG
                  ************************************************************

HsCD00075599      AATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGTGGTGTGTGGACGCT
NM_003757.2       AATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGTGGTGTGTGGACGCT
                  ************************************************************

HsCD00075599      GACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCTGTCGTCTCTGGGAC
NM_003757.2       GACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCTGTCGTCTCTGGGAC
                  ************************************************************

HsCD00075599      TGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTGTCCGGACCTGCGGT
NM_003757.2       TGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTGTCCGGACCTGCGGT
                  ************************************************************

HsCD00075599      TTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGATGGGCTACCAGTGC
NM_003757.2       TTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGATGGGCTACCAGTGC
                  ************************************************************

HsCD00075599      TTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACAATGAGCCCTACATG
NM_003757.2       TTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACAATGAGCCCTACATG
                  ************************************************************

HsCD00075599      AAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGACCCCTGGGGGAGTGC
NM_003757.2       AAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGACCCCTGGGGGAGTGC
                  ************************************************************

HsCD00075599      ATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCAAGTCTGGAGAGGTG
NM_003757.2       ATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCAAGTCTGGAGAGGTG
                  ************************************************************

HsCD00075599      TTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGTTATCCAGGGACATG
NM_003757.2       TTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGTTATCCAGGGACATG
                  ************************************************************

HsCD00075599      ACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTGACTCCACAACTCTT
NM_003757.2       ACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTGACTCCACAACTCTT
                  ************************************************************

HsCD00075599      GAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTGCCCTCTCCCCCAAC
NM_003757.2       GAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTGCCCTCTCCCCCAAC
                  ************************************************************

HsCD00075599      TATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAACCACAACCTCCACC
NM_003757.2       TATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAACCACAACCTCCACC
                  ************************************************************

HsCD00075599      AGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAGAAGAGTTTGGAAGA
NM_003757.2       AGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAGAAGAGTTTGGAAGA
                  ************************************************************

HsCD00075599      GTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTGATGGCAAGAGCTAC
NM_003757.2       GTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTGATGGCAAGAGCTAC
                  ************************************************************

HsCD00075599      AGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACCCACAGTACTTTGAA
NM_003757.2       AGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACCCACAGTACTTCGAA
                  ******************************************************** ***

HsCD00075599      TTTGAGTTTGAGGCTTAG
NM_003757.2       TTTGAGTTTGAGGCTTAA
                  *****************.

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Cap-dependent Translation Initiation
Reactome : Eukaryotic Translation Initiation
Reactome : Formation of a pool of free 40S subunits
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of proteins
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
WikiPathway : Translation Factors

Protein

SMART domain : WD40 : WD40 repeats
UniProt : Q5U0F4
UniProt : Q13347
HPRD : 04884

Clone

Cloning Information : 252258
HIP Master Clone ID : 6869
Original Clone ID : FLH252258.01X

Organism


TAX_ID : 9606
Species Specific ID: 8668

Genome

Chromosome : 1
Map Location : 1p34.1
Ensembl : ENSG00000084623

Reagents

Labome : EIF3I-antibody