DNASU Plasmid Repository • 480.965.5697 | Email

NRG1 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  NRG1
Gene Name:  neuregulin 1
Original Clone ID: FLH252265.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 891nts         Open reading frame : 1 to 891
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1543
Start on reference sequence 653
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : NRG1
Symbol Nomenclature : NRG1
Designation : MSTP131|glial growth factor|heregulin, alpha (45kD, ERBB2 p185-activator)|neu differentiation factor|neuregulin 1 type IV beta 1a|neuregulin 1 type IV beta 3|pro-NRG1|pro-neuregulin-1, membrane-bound isoform|sensory and motor neuron derived factor
Full Nomenclature : neuregulin 1
GENEID : 3084
HGNC : 7997
MIM : 142445
Vega : OTTHUMG00000163918
Target GenBank: BC007675


Reference Sequence Alignment


HsCD00075877        ------------------------------------------------------------
NM_001160001.1      ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013956.3         ------------------------------------------------------------
NM_001159995.1      ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_013957.3         ------------------------------------------------------------
NM_001159999.1      ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        -------------------------------------------------------ATGGA
NM_001160001.1      ------------------------------------------------------------
NM_001159995.1      ------------------------------------------------------------
NM_013959.3         -------------------------------------------------------ATGGA
NM_001159999.1      ------------------------------------------------------------

                                    .               *                .*       * 

                             .            .         *..*  . ..  ..     .        

HsCD00075877        GACTG-------------------------------------------------------
NM_001160001.1      GTGTG------------------------------------------------------A
NM_013962.2         GGGGG-------------------------------------------------------
NM_013956.3         GTGTG------------------------------------------------------A
NM_001159995.1      GTGTG------------------------------------------------------A
NM_013959.3         GACTG-------------------------------------------------------
NM_013957.3         GTGTG------------------------------------------------------A
NM_001159999.1      GTGTG------------------------------------------------------A
NM_001160004.1      GTGTG------------------------------------------------------A
NM_001160008.1      GTGTG------------------------------------------------------A

HsCD00075877        ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------

                       .             .  .:.:  :*   * .          .  .   .   *:   

                    .    *         .              ** *   :   .     :   *.    .  

HsCD00075877        TTG---------------------------------------------------------
NM_001160001.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_013956.3         AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001159995.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_013959.3         TTG---------------------------------------------------------
NM_013957.3         AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001159999.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001160004.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC
NM_001160008.1      AGG--------------------------------------AAATGACAGTGCCTCTGCC

HsCD00075877        ------------------------------------------------------------
NM_001160001.1      AATATCACCATCGTG---------------------------------------------
NM_013959.3         ------------------------------------------------------------

HsCD00075877        ----------------------------------------------------CCTGGTCA
NM_001160001.1      ---------------------------------------------------------GAA
NM_001159995.1      -------------------------------------------------GAGCATATGTG
NM_013959.3         ----------------------------------------------------CCTGGTCA

                     .       :   . :.. .  *       .           . .* .*      * .  

                    ..  :..    *:    **     ..**.  .   ** *                     

                                        . .  .       :   *:      *              

HsCD00075877        GTGGGTGTCGTCTGAGG-------------------------------------------
XM_005273487.1      ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
NM_013962.2         ACGGGCCGGAACCTCAAGAAGGAGG---------------------------------TC
NM_013959.3         GTGGGTGTCGTCTGAGG-------------------------------------------
NM_013957.3         ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
NM_001160004.1      ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
NM_001160008.1      ATGGCCAGCTTCTACAAGGCGGAGG------------------------AGCTGTACCAG
                       .      :*  ...                                           

HsCD00075877        -----------------------CATACACTTCACCTGTCTCTAGGGCTCAATCTGAAAG
NM_013959.3         -----------------------CATACACTTCACCTGTCTCTAGGGCTCAATCTGAAAG
                                           *. .       **    *  :.*     *:.:   . 

                      .    *     . :  .... .  .*:  * :.: . .  . *   ... :*: *   

                    . .. .: *..   .:   * : :     :  .:   :   ..:  .*  . *..:..::

HsCD00075877        CCCTTCACCCACCCGGAACCCTGAGG-----------------------TGAGAACGCCC
NM_013959.3         CCCTTCACCCACCCGGAACCCTGAGG-----------------------TGAGAACGCCC
                    . * : . .*. . ..:. *. *  .                        .: *    * 

                    .: :  . *    : .     * *.: . ... *..* .  : . ..*:*  .**.:.* 

                    :  : .. * :  :  .. . :  *  *.  . :*:   * ..   *   .... .    

                                         .***   :** ***.*: * .. * ..* * *..:..: 

                    *.:.. *: : .*.***.:* .*. .*  .:*.... * * :****. : :. :**  .*

                    **  .. .:***:.* *..* .  ..   *:....:**  * ..* ***: * . .    

HsCD00075877        CCTGAATAG---------------------------------------------------
NM_013962.2         CCTGAATAG---------------------------------------------------
NM_013959.3         CCTGAATAG---------------------------------------------------
NM_001160008.1      CCTCATAGTGAAAGGTAA------------------------------------------
                    *** *::.                                                    

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      GGCTTCATTCTCTAA---------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ------------------------------------------------------------
NM_013962.2         ------------------------------------------------------------
NM_013959.3         ------------------------------------------------------------
NM_001160004.1      ------------------------------------------------------------
NM_001160008.1      ------------------------------------------------------------

HsCD00075877        ---------
XM_005273487.1      GCTGTATAA
NM_001160001.1      GCTGTATAA
NM_013962.2         ---------
XM_005273486.1      GCTGTATAA
NM_013956.3         GCTGTATAA
NM_001159995.1      GCTGTATAA
NM_013959.3         ---------
NM_013957.3         GCTGTATAA
XM_005273485.1      GCTGTATAA
NM_001159999.1      GCTGTATAA
NM_001160004.1      ---------
NM_001160008.1      ---------


NCI : Glypican 1 network
NCI : Validated transcriptional targets of deltaNp63 isoforms
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in ERBB2 signaling
Reactome : GRB7 events in ERBB2 signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear signaling by ERBB4
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : ErbB signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy


SMART domain : EGF : Epidermal growth factor-like domain.
UniProt : B0FYA9
UniProt : Q02297
UniProt : Q7RTW3
UniProt : Q6PK61
UniProt : B0FYA8
UniProt : B0FYA7
UniProt : B7Z4Z3
UniProt : A6MW55
UniProt : A6MW56
UniProt : B0FWZ3
UniProt : Q7RTW5
UniProt : E9PHH4
UniProt : B7Z1D7
HPRD : 00802


Cloning Information : 252265
HIP Master Clone ID : 28243
Original Clone ID : FLH252265.01X


TAX_ID : 9606
Species Specific ID: 3084


Chromosome : 8
Map Location : 8p12
Ensembl : ENSG00000157168


Labome : NRG1-antibody