DNASU Plasmid Repository • 480.965.5697 | Email

UBA2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBA2
Gene Name:  ubiquitin-like modifier activating enzyme 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH197169.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 25072996
Title: Analysis of Changes in SUMO-2/3 Modification during Breast Cancer Progression and Metastasis.
Authors: HIP
HsCD00076329

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1923nts         Open reading frame : 1 to 1923
Reference Sequence Alignment

ATGGCACTGTCGCGGGGGCTGCCCCGGGAGCTGGCTGAGGCGGTGGCCGGGGGCCGGGTG
CTGGTGGTGGGGGCGGGCGGCATCGGCTGCGAGCTCCTCAAGAATCTCGTGCTCACCGGT
TTCTCCCACATCGACCTGATTGATCTGGATACTATTGATGTAAGCAACCTCAACAGACAG
TTTTTGTTTCAAAAGAAACATGTTGGAAGATCAAAGGCACAGGTTGCCAAGGAAAGTGTA
CTGCAGTTTTACCCGAAAGCTAATATCGTTGCCTACCATGACAGCATCATGAACCCTGAC
TATAATGTGGAATTTTTCCGACAGTTTATACTGGTTATGAATGCTTTAGATAACAGAGCT
GCCCGAAACCATGTTAATAGAATGTGCCTGGCAGCTGATGTTCCTCTTATTGAAAGTGGA
ACAGCTGGGTATCTTGGACAAGTAACTACTATCAAAAAGGGTGTGACCGAGTGTTATGAG
TGTCATCCTAAGCCGACCCAGAGAACCTTTCCTGGCTGTACAATTCGTAACACACCTTCA
GAACCTATACATTGCATCGTTTGGGCAAAGTACTTGTTCAACCAGTTGTTTGGGGAAGAA
GATGCTGATCAAGAAGTATCTCCTGACAGAGCTGACCCTGAAGCTGCCTGGGAACCAACG
GAAGCCGAAGCCAGAGCTAGAGCATCTAATGAAGATGGTGACATTAAACGTATTTCTACT
AAGGAATGGGCTAAATCAACTGGATATGATCCAGTTAAACTTTTTACCAAGCTTTTTAAA
GATGACATCAGGTATCTGTTGACAATGGACAAACTATGGCGGAAAAGGAAACCTCCAGTT
CCGTTGGACTGGGCTGAAGTACAAAGTCAAGGAGAAGAAACGAATGCATCAGATCAACAG
AATGAACCCCAGTTAGGCCTGAAAGACCAGCAGGTTCTAGATGTAAAGAGCTATGCACGT
CTTTTTTCAAAGAGCATCGAGACTTTGAGAGTTCATTTAGCAGAAAAGGGGGATGGAGCT
GAGCTCATATGGGATAAGGATGACCCATCTGCAATGGATTTTGTCACCTCTGCTGCAAAC
CTCAGGATGCATATTTTCAGTATGAATATGAAGAGTAGATTTGATATCAAATCAATGGCA
GGGAACATTATTCCTGCTATTGCTACTACTAATGCAGTAATTGCTGGGTTGATAGTATTG
GAAGGATTGAAGATTTTATCAGGAAAAATAGACCAGTGCAGAACAATTTTTTTGAATAAA
CAACCAAACCCAAGAAAGAAGCTTCTTGTGCCTTGTGCACTGGATCCTCCCAACCCCAAT
TGTTATGTATGTGCCAGCAAGCCAGAGGTGACTGTGCGGCTGAATGTCCATAAAGTGACT
GTTCTCACCTTACAAGACAAGATAGTGAAAGAAAAATTTGCTATGGTAGCACCAGATGTC
CAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCT
AATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGAT
GACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAG
GACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAA
GATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACA
GCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCGGATGAAGAAGATTCTTCAAATAAT
GCCGACGTCAGTGAAGAAGAGAGAAGCCGCAAGAGGAAATTAGATGAGAAAGAGAATCTC
AGTGCAAAGAGGTCACGTATAGAACAGAAGGAAGAGCTTGATGATGTCATAGCATTAGAT
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1971
Start on reference sequence 49
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBA2
Symbol Nomenclature : UBA2
SYNONYM : ARX; SAE2
Designation : SUMO-1 activating enzyme subunit 2|SUMO-activating enzyme subunit 2|SUMO1 activating enzyme subunit 2|UBA2, ubiquitin-activating enzyme E1 homolog|anthracycline-associated resistance ARX|ubiquitin-like 1-activating enzyme E1B|ubiquitin-like modifier-activating enzyme 2
Full Nomenclature : ubiquitin-like modifier activating enzyme 2
GENEID : 10054
Locus Tag : HRIHFB2115
HGNC : 30661
MIM : 613295
Vega : OTTHUMG00000182090
Target GenBank: BC003153

 

Reference Sequence Alignment

  

HsCD00076329        ATGGCACTGTCGCGGGGGCTGCCCCGGGAGCTGGCTGAGGCGGTGGCCGGGGGCCGGGTG
NM_005499.2         ATGGCACTGTCGCGGGGGCTGCCCCGGGAGCTGGCTGAGGCGGTGGCCGGGGGCCGGGTG
XM_005258403.1      ATGGCACTGTCGCGGGGGCTGCCCCGGGAGCTGGCTGAGGCGGTGGCCGGGGGCCGGGTG
                    ************************************************************

HsCD00076329        CTGGTGGTGGGGGCGGGCGGCATCGGCTGCGAGCTCCTCAAGAATCTCGTGCTCACCGGT
NM_005499.2         CTGGTGGTGGGGGCGGGCGGCATCGGCTGCGAGCTCCTCAAGAATCTCGTGCTCACCGGT
XM_005258403.1      CTGGTGGTGGGGGCGGGCGGCATCGGCTGCGAGCTCCTCAAGAATCTCGTGCTCACCGGT
                    ************************************************************

HsCD00076329        TTCTCCCACATCGACCTGATTGATCTGGATACTATTGATGTAAGCAACCTCAACAGACAG
NM_005499.2         TTCTCCCACATCGACCTGATTGATCTGGATACTATTGATGTAAGCAACCTCAACAGACAG
XM_005258403.1      TTCTCCCACATCGACCTGATTGATCTGGATACTATTGATGTAAGCAACCTCAACAGACAG
                    ************************************************************

HsCD00076329        TTTTTGTTTCAAAAGAAACATGTTGGAAGATCAAAGGCACAGGTTGCCAAGGAAAGTGTA
NM_005499.2         TTTTTGTTTCAAAAGAAACATGTTGGAAGATCAAAGGCACAGGTTGCCAAGGAAAGTGTA
XM_005258403.1      TTTTTGTTTCAAAAGAAACATGTTGGAAGATCAAAGGCACAGGTTGCCAAGGAAAGTGTA
                    ************************************************************

HsCD00076329        CTGCAGTTTTACCCGAAAGCTAATATCGTTGCCTACCATGACAGCATCATGAACCCTGAC
NM_005499.2         CTGCAGTTTTACCCGAAAGCTAATATCGTTGCCTACCATGACAGCATCATGAACCCTGAC
XM_005258403.1      CTGCAGTTTTACCCGAAAGCTAATATCGTTGCCTACCATGACAGCATCATGAACCCTGAC
                    ************************************************************

HsCD00076329        TATAATGTGGAATTTTTCCGACAGTTTATACTGGTTATGAATGCTTTAGATAACAGAGCT
NM_005499.2         TATAATGTGGAATTTTTCCGACAGTTTATACTGGTTATGAATGCTTTAGATAACAGAGCT
XM_005258403.1      TATAATGTGGAATTTTTCCGACAGTTTATACTGGTTATGAATGCTTTAGATAACAGAGCT
                    ************************************************************

HsCD00076329        GCCCGAAACCATGTTAATAGAATGTGCCTGGCAGCTGATGTTCCTCTTATTGAAAGTGGA
NM_005499.2         GCCCGAAACCATGTTAATAGAATGTGCCTGGCAGCTGATGTTCCTCTTATTGAAAGTGGA
XM_005258403.1      GCCCGAAACCATGTTAATAGAATGTGCCTGGCAGCTGATGTTCCTCTTATTGAAAGTGGA
                    ************************************************************

HsCD00076329        ACAGCTGGGTATCTTGGACAAGTAACTACTATCAAAAAGGGTGTGACCGAGTGTTATGAG
NM_005499.2         ACAGCTGGGTATCTTGGACAAGTAACTACTATCAAAAAGGGTGTGACCGAGTGTTATGAG
XM_005258403.1      ACAGCTGGGTATCTTGGACAAGTAACTACTATCAAAAAGGGTGTGACCGAGTGTTATGAG
                    ************************************************************

HsCD00076329        TGTCATCCTAAGCCGACCCAGAGAACCTTTCCTGGCTGTACAATTCGTAACACACCTTCA
NM_005499.2         TGTCATCCTAAGCCGACCCAGAGAACCTTTCCTGGCTGTACAATTCGTAACACACCTTCA
XM_005258403.1      TGTCATCCTAAGCCGACCCAGAGAACCTTTCCTGGCTGTACAATTCGTAACACACCTTCA
                    ************************************************************

HsCD00076329        GAACCTATACATTGCATCGTTTGGGCAAAGTACTTGTTCAACCAGTTGTTTGGGGAAGAA
NM_005499.2         GAACCTATACATTGCATCGTTTGGGCAAAGTACTTGTTCAACCAGTTGTTTGGGGAAGAA
XM_005258403.1      GAACCTATACATTGCATCGTTTGGGCAAAGTACTTGTTCAACCAGTTGTTTGGGGAAGAA
                    ************************************************************

HsCD00076329        GATGCTGATCAAGAAGTATCTCCTGACAGAGCTGACCCTGAAGCTGCCTGGGAACCAACG
NM_005499.2         GATGCTGATCAAGAAGTATCTCCTGACAGAGCTGACCCTGAAGCTGCCTGGGAACCAACG
XM_005258403.1      GATGCTGATCAAGAAGTATCTCCTGACAGAGCTGACCCTGAAGCTGCCTGGGAACCAACG
                    ************************************************************

HsCD00076329        GAAGCCGAAGCCAGAGCTAGAGCATCTAATGAAGATGGTGACATTAAACGTATTTCTACT
NM_005499.2         GAAGCCGAAGCCAGAGCTAGAGCATCTAATGAAGATGGTGACATTAAACGTATTTCTACT
XM_005258403.1      GAAGCCGAAGCCAGAGCTAGAGCATCTAATGAAGATGGTGACATTAAACGTATTTCTACT
                    ************************************************************

HsCD00076329        AAGGAATGGGCTAAATCAACTGGATATGATCCAGTTAAACTTTTTACCAAGCTTTTTAAA
NM_005499.2         AAGGAATGGGCTAAATCAACTGGATATGATCCAGTTAAACTTTTTACCAAGCTTTTTAAA
XM_005258403.1      AAGGAATGGGCTAAATCAACTGGATATGATCCAGTTAAACTTTTTACCAAGCTTTTTAAA
                    ************************************************************

HsCD00076329        GATGACATCAGGTATCTGTTGACAATGGACAAACTATGGCGGAAAAGGAAACCTCCAGTT
NM_005499.2         GATGACATCAGGTATCTGTTGACAATGGACAAACTATGGCGGAAAAGGAAACCTCCAGTT
XM_005258403.1      GATGACATCAGGTATCTGTTGACAATGGACAAACTATGGCGGAAAAGGAAACCTCCAGTT
                    ************************************************************

HsCD00076329        CCGTTGGACTGGGCTGAAGTACAAAGTCAAGGAGAAGAAACGAATGCATCAGATCAACAG
NM_005499.2         CCGTTGGACTGGGCTGAAGTACAAAGTCAAGGAGAAGAAACGAATGCATCAGATCAACAG
XM_005258403.1      CCGTTGGACTGGGCTGAAGTACAAAGTCAAGGAGAAGAAACGAATGCATCAGATCAACAG
                    ************************************************************

HsCD00076329        AATGAACCCCAGTTAGGCCTGAAAGACCAGCAGGTTCTAGATGTAAAGAGCTATGCACGT
NM_005499.2         AATGAACCCCAGTTAGGCCTGAAAGACCAGCAGGTTCTAGATGTAAAGAGCTATGCACGT
XM_005258403.1      AATGAACCCCAGTTAGGCCTGAAAGACCAGCAGGTTCTAGATGTAAAGAGCTATGCACGT
                    ************************************************************

HsCD00076329        CTTTTTTCAAAGAGCATCGAGACTTTGAGAGTTCATTTAGCAGAAAAGGGGGATGGAGCT
NM_005499.2         CTTTTTTCAAAGAGCATCGAGACTTTGAGAGTTCATTTAGCAGAAAAGGGGGATGGAGCT
XM_005258403.1      CTTTTTTCAAAGAGCATCGAGACTTTGAGAGTTCATTTAGCAGAAAAGGGGGATGGAGCT
                    ************************************************************

HsCD00076329        GAGCTCATATGGGATAAGGATGACCCATCTGCAATGGATTTTGTCACCTCTGCTGCAAAC
NM_005499.2         GAGCTCATATGGGATAAGGATGACCCATCTGCAATGGATTTTGTCACCTCTGCTGCAAAC
XM_005258403.1      GAGCTCATATGGGATAAGGATGACCCATCTGCAATGGATTTTGTCACCTCTGCTGCAAAC
                    ************************************************************

HsCD00076329        CTCAGGATGCATATTTTCAGTATGAATATGAAGAGTAGATTTGATATCAAATCAATGGCA
NM_005499.2         CTCAGGATGCATATTTTCAGTATGAATATGAAGAGTAGATTTGATATCAAATCAATGGCA
XM_005258403.1      CTCAGGATGCATATTTTCAGTATGAATATGAAGAGTAGATTTGATATCAAATCAATGGCA
                    ************************************************************

HsCD00076329        GGGAACATTATTCCTGCTATTGCTACTACTAATGCAGTAATTGCTGGGTTGATAGTATTG
NM_005499.2         GGGAACATTATTCCTGCTATTGCTACTACTAATGCAGTAATTGCTGGGTTGATAGTATTG
XM_005258403.1      GGGAACATTATTCCTGCTATTGCTACTACTAATGCAGTAATTGCTGGGTTGATAGTATTG
                    ************************************************************

HsCD00076329        GAAGGATTGAAGATTTTATCAGGAAAAATAGACCAGTGCAGAACAATTTTTTTGAATAAA
NM_005499.2         GAAGGATTGAAGATTTTATCAGGAAAAATAGACCAGTGCAGAACAATTTTTTTGAATAAA
XM_005258403.1      GAAGGATTGAAGATTTTATCAGGAAAAATAGACCAGTGCAGAACAATAG-----------
                    ***********************************************:            

HsCD00076329        CAACCAAACCCAAGAAAGAAGCTTCTTGTGCCTTGTGCACTGGATCCTCCCAACCCCAAT
NM_005499.2         CAACCAAACCCAAGAAAGAAGCTTCTTGTGCCTTGTGCACTGGATCCTCCCAACCCCAAT
XM_005258403.1      ------------------------------------------------------------
                                                                                

HsCD00076329        TGTTATGTATGTGCCAGCAAGCCAGAGGTGACTGTGCGGCTGAATGTCCATAAAGTGACT
NM_005499.2         TGTTATGTATGTGCCAGCAAGCCAGAGGTGACTGTGCGGCTGAATGTCCATAAAGTGACT
XM_005258403.1      ------------------------------------------------------------
                                                                                

HsCD00076329        GTTCTCACCTTACAAGACAAGATAGTGAAAGAAAAATTTGCTATGGTAGCACCAGATGTC
NM_005499.2         GTTCTCACCTTACAAGACAAGATAGTGAAAGAAAAATTTGCTATGGTAGCACCAGATGTC
XM_005258403.1      -------------------------TGAAAGAAAAATTTGCTATGGTAGCACCAGATGTC
                                             ***********************************

HsCD00076329        CAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCT
NM_005499.2         CAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCT
XM_005258403.1      CAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCT
                    ************************************************************

HsCD00076329        AATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGAT
NM_005499.2         AATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGAT
XM_005258403.1      AATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGAT
                    ************************************************************

HsCD00076329        GACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAG
NM_005499.2         GACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAG
XM_005258403.1      GACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAG
                    ************************************************************

HsCD00076329        GACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAA
NM_005499.2         GACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAA
XM_005258403.1      GACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAA
                    ************************************************************

HsCD00076329        GATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACA
NM_005499.2         GATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACA
XM_005258403.1      GATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACA
                    ************************************************************

HsCD00076329        GCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCGGATGAAGAAGATTCTTCAAATAAT
NM_005499.2         GCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCAGATGAAGAAGATTCTTCAAATAAT
XM_005258403.1      GCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCAGATGAAGAAGATTCTTCAAATAAT
                    ***********************************.************************

HsCD00076329        GCCGACGTCAGTGAAGAAGAGAGAAGCCGCAAGAGGAAATTAGATGAGAAAGAGAATCTC
NM_005499.2         GCCGACGTCAGTGAAGAAGAGAGAAGCCGCAAGAGGAAATTAGATGAGAAAGAGAATCTC
XM_005258403.1      GCCGACGTCAGTGAAGAAGAGAGAAGCCGCAAGAGGAAATTAGATGAGAAAGAGAATCTC
                    ************************************************************

HsCD00076329        AGTGCAAAGAGGTCACGTATAGAACAGAAGGAAGAGCTTGATGATGTCATAGCATTAGAT
NM_005499.2         AGTGCAAAGAGGTCACGTATAGAACAGAAGGAAGAGCTTGATGATGTCATAGCATTAGAT
XM_005258403.1      AGTGCAAAGAGGTCACGTATAGAACAGAAGGAAGAGCTTGATGATGTCATAGCATTAGAT
                    ************************************************************

HsCD00076329        TTG
NM_005499.2         TGA
XM_005258403.1      TGA
                    * .

Pathways

Panther : Ubiquitin proteasome pathway
Reactome : Metabolism of proteins
Reactome : Post-translational protein modification
Reactome : Processing and activation of SUMO
Reactome : SUMO is conjugated to E1 (UBA2:SAE1)
Reactome : SUMO is transferred from E1 to E2 (UBE2I, UBC9)
Reactome : SUMOylation

Protein

UniProt : Q9UBT2
HPRD : 11658

Clone

Cloning Information : 197169
HIP Master Clone ID : 171880
Original Clone ID : FLH197169.01L

Organism


TAX_ID : 9606
Species Specific ID: 10054

Genome

Chromosome : 19
Map Location : 19q12
Ensembl : ENSG00000126261

Reagents

Labome : UBA2-antibody