DNASU Plasmid Repository • 480.965.5697 | Email

ARRB2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARRB2
Gene Name:  arrestin, beta 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH263877.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00076400

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1230nts         Open reading frame : 1 to 1230
Reference Sequence Alignment

ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCATA
CCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAGGCC
TGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGCCAC
AAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCCGGC
CCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCACCTC
GAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTCCAC
GTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTACGCC
GACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAAGAT
GACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTCAGT
GACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACCAAC
CTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTGGTG
TCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAGCTG
CCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAGTCA
GCCGCTCCGGAGACAGATGTCCCTGTGGACACCAACCTCATTGAATTTGATACCAACTAT
GCCACAGATGATGACATTGTGTTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAG
GATGACGACTATGATGATCAACTCTGCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1283
Start on reference sequence 54
Mutations:
None
Discrepancy:
g426c; c840t
                                

5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARRB2
Symbol Nomenclature : ARRB2
SYNONYM : ARB2; ARR2; BARR2
Designation : arrestin 3|arrestin beta-2|beta-arrestin-2
Full Nomenclature : arrestin, beta 2
GENEID : 409
HGNC : 712
MIM : 107941
Vega : OTTHUMG00000090759
Target GenBank: NM_004313

 

Reference Sequence Alignment

  

HsCD00076400        ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_001257328.1      ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_001257331.1      ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_001257330.1      ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_004313.3         ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_199004.1         ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
                    ************************************************************

HsCD00076400        GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_001257328.1      GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_001257331.1      GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGTG---
NM_001257330.1      GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_004313.3         GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_199004.1         GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGTG---
                    *******************************************************:    

HsCD00076400        GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_001257328.1      GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_001257331.1      ------------------------------------------TTTGTGACCCTCACCTGC
NM_001257330.1      GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_004313.3         GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_199004.1         ------------------------------------------TTTGTGACCCTCACCTGC
                                                              ******************

HsCD00076400        GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_001257328.1      GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_001257331.1      GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_001257330.1      GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_004313.3         GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_199004.1         GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
                    ************************************************************

HsCD00076400        TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_001257328.1      TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_001257331.1      TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_001257330.1      TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_004313.3         TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_199004.1         TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
                    ************************************************************

HsCD00076400        CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_001257328.1      CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCGTG
NM_001257331.1      CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_001257330.1      CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_004313.3         CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_199004.1         CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
                    *********************************************************.* 

HsCD00076400        ------------------------------------------------------------
NM_001257328.1      AGGATGCCCCTGCCCTCTGAGGGCCAGGGGGCTGGGGCTGGGACTGTGTCTGGGGTGGGG
NM_001257331.1      ------------------------------------------------------------
NM_001257330.1      ------------------------------------------------------------
NM_004313.3         ------------------------------------------------------------
NM_199004.1         ------------------------------------------------------------
                                                                                

HsCD00076400        --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_001257328.1      ATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_001257331.1      --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_001257330.1      --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_004313.3         --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_199004.1         --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
                      **********************************************************

HsCD00076400        GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_001257328.1      GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_001257331.1      GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_001257330.1      GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_004313.3         GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_199004.1         GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
                    ************************************************************

HsCD00076400        CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_001257328.1      CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_001257331.1      CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_001257330.1      CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_004313.3         CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_199004.1         CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
                    ************************************************************

HsCD00076400        GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_001257328.1      GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_001257331.1      GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_001257330.1      GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_004313.3         GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_199004.1         GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
                    ************************************************************

HsCD00076400        CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_001257328.1      CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_001257331.1      CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_001257330.1      CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_004313.3         CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_199004.1         CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
                    ************************************************************

HsCD00076400        CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_001257328.1      CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_001257331.1      CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_001257330.1      CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_004313.3         CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_199004.1         CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
                    ************************************************************

HsCD00076400        GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_001257328.1      GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_001257331.1      GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_001257330.1      GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_004313.3         GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_199004.1         GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
                    ************************************************************

HsCD00076400        GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_001257328.1      GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_001257331.1      GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_001257330.1      GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_004313.3         GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_199004.1         GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
                    ************************************************************

HsCD00076400        AGTGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_001257328.1      AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_001257331.1      AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_001257330.1      AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_004313.3         AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_199004.1         AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
                    ** *********************************************************

HsCD00076400        AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_001257328.1      AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_001257331.1      AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_001257330.1      AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_004313.3         AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_199004.1         AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
                    ************************************************************

HsCD00076400        GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_001257328.1      GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_001257331.1      GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_001257330.1      GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_004313.3         GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_199004.1         GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
                    ************************************************************

HsCD00076400        CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_001257328.1      CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_001257331.1      CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_001257330.1      CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_004313.3         CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_199004.1         CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
                    ************************************************************

HsCD00076400        ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
NM_001257328.1      ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
NM_001257331.1      TCAGCACCCACCCCCACACCCCCTCTTCCCGTCCCCCCAGCCGCTCCGGAGACAGATGTC
NM_001257330.1      TCAGCACCCACCCCCACACCCCCTCTTCCCGTCCCCCCAGCCGCTCCGGAGACAGATGTC
NM_004313.3         ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
NM_199004.1         ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
                                                         ***********************

HsCD00076400        CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_001257328.1      CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_001257331.1      CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_001257330.1      CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_004313.3         CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_199004.1         CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
                    ************************************************************

HsCD00076400        TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_001257328.1      TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_001257331.1      TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_001257330.1      TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_004313.3         TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_199004.1         TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
                    ************************************************************

HsCD00076400        CTCTGCTTG
NM_001257328.1      CTCTGCTAG
NM_001257331.1      CTCTGCTAG
NM_001257330.1      CTCTGCTAG
NM_004313.3         CTCTGCTAG
NM_199004.1         CTCTGCTAG
                    *******:*

Pathways

NCI : ALK1 signaling events
NCI : Arf6 signaling events
NCI : Atypical NF-kappaB pathway
NCI : CXCR4-mediated signaling events
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Noncanonical Wnt signaling pathway
NCI : Signaling events mediated by the Hedgehog family
NCI : TGF-beta receptor signaling
NCI : Thromboxane A2 receptor signaling
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Wnt signaling pathway
Reactome : Activated NOTCH1 Transmits Signal to the Nucleus
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Hemostasis
Reactome : PCP/CE pathway
Reactome : Platelet activation, signaling and aggregation
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by Wnt
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : MAPK signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : Arrestin_C : Arrestin (or S-antigen), C-terminal domain
UniProt : P32121
HPRD : 00147

Clone

Cloning Information : 263877
HIP Master Clone ID : 196571
Original Clone ID : FLH263877.01L

Organism


TAX_ID : 9606
Species Specific ID: 409

Genome

Chromosome : 17
Map Location : 17p13
Ensembl : ENSG00000141480

Reagents

Labome : ARRB2-antibody