DNASU Plasmid Repository • 480.965.5697 | Email

MAP2K3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAP2K3
Gene Name:  mitogen-activated protein kinase kinase 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020778.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000767

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 957nts         Open reading frame : 1 to 957
Reference Sequence Alignment

ATGTCCAAGCCACCCGCACCCAACCCCACACCCCCCCGGAACCTGGACTCCCGGACCTTC
ATCACCATTGGAGACAGAAACTTTGAGGTGGAGGCTGATGACTTGGTGACCATCTCAGAA
CTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCACGCCCAGAGCGGCACCATC
ATGGCCGTGAAGCGGATCCGGGCCACCGTGAACTCACAGGAGCAGAAGCGGCTGCTCATG
GACCTGGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTACGGGGCA
CTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGGACACATCCTTGGACAAG
TTCTACCGGAAGGTGCTGGATAAAAACATGACAATTCCAGAGGACATCCTTGGGGAGATT
GCTGTGTCTATCGTGCGGGCCCTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGA
GATGTGAAGCCCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTTT
GGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCCGGCTGCAAGCCC
TACATGGCCCCTGAGAGGATCAACCCAGAGCTGAACCAGAAGGGCTACAATGTCAAGTCC
GACGTCTGGAGCCTGGGCATCACCATGATTGAGATGGCCATCCTGCGGTTCCCTTACGAG
TCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAGGTGGTGGAGGAGCCGTCCCCCCAGCTC
CCAGCCGACCGTTTCTCCCCCGAGTTTGTGGACTTCACTGCTCAGTGCCTGAGGAAGAAC
CCCGCAGAGCGTATGAGCTACCTGGAGCTGATGGAGCACCCCTTCTTCACCTTGCACAAA
ACCAAGAAGACGGACATTGCTGCCTTCGTGAAGGAGATCCTGGGAGAAGACTCATGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1294
Start on reference sequence 338
Mutations:
None
Discrepancy:
a934g,K312E
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAP2K3
Symbol Nomenclature : MAP2K3
SYNONYM : MAPKK3; MEK3; MKK3; PRKMK3; SAPKK-2; SAPKK2
Designation : MAP kinase kinase 3|MAPK/ERK kinase 3|MAPKK 3|MEK 3|SAPK kinase 2|dual specificity mitogen-activated protein kinase kinase 3|stress-activated protein kinase kinase 2
Full Nomenclature : mitogen-activated protein kinase kinase 3
GENEID : 5606
GI : 61366936
GenBank Accession : AY890994
HGNC : 6843
MIM : 602315
Vega : OTTHUMG00000134322
Target GenBank: NM_002756

 

Reference Sequence Alignment

  

HsCD00000767        ------------------------------------------------------------
XM_005256723.1      ------------------------------------------------------------
NM_002756.4         ------------------------------------------------------------
NM_145109.2         ATGGAGTCGCCCGCCTCGAGCCAGCCCGCCAGCATGCCCCAGTCCAAAGGAAAATCCAAG
XM_005256722.1      ------------------------------------------------------------
                                                                                

HsCD00000767        ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
XM_005256723.1      ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
NM_002756.4         ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
NM_145109.2         AGGAAGAAGGATCTACGGATATCCTGCATGTCCAAGCCACCCGCACCCAACCCCACACCC
XM_005256722.1      ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
                                               *********************************

HsCD00000767        CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
XM_005256723.1      CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
NM_002756.4         CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
NM_145109.2         CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
XM_005256722.1      CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
                    ************************************************************

HsCD00000767        GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
XM_005256723.1      GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
NM_002756.4         GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
NM_145109.2         GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
XM_005256722.1      GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
                    ************************************************************

HsCD00000767        GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
XM_005256723.1      GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
NM_002756.4         GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
NM_145109.2         GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
XM_005256722.1      GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
                    ************************************************************

HsCD00000767        TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
XM_005256723.1      TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
NM_002756.4         TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
NM_145109.2         TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
XM_005256722.1      TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
                    ************************************************************

HsCD00000767        TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
XM_005256723.1      TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
NM_002756.4         TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
NM_145109.2         TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
XM_005256722.1      TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
                    ************************************************************

HsCD00000767        GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
XM_005256723.1      GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
NM_002756.4         GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
NM_145109.2         GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
XM_005256722.1      GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
                    ************************************************************

HsCD00000767        ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
XM_005256723.1      ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
NM_002756.4         ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
NM_145109.2         ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
XM_005256722.1      ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
                    ************************************************************

HsCD00000767        CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
XM_005256723.1      CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
NM_002756.4         CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
NM_145109.2         CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
XM_005256722.1      CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
                    ************************************************************

HsCD00000767        GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
XM_005256723.1      GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
NM_002756.4         GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
NM_145109.2         GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
XM_005256722.1      GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
                    ************************************************************

HsCD00000767        AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
XM_005256723.1      AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
NM_002756.4         AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
NM_145109.2         AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
XM_005256722.1      AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
                    ************************************************************

HsCD00000767        AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
XM_005256723.1      AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
NM_002756.4         AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
NM_145109.2         AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
XM_005256722.1      AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
                    ************************************************************

HsCD00000767        ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
XM_005256723.1      ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
NM_002756.4         ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
NM_145109.2         ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
XM_005256722.1      ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
                    ************************************************************

HsCD00000767        GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
XM_005256723.1      GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
NM_002756.4         GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
NM_145109.2         GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
XM_005256722.1      GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
                    ************************************************************

HsCD00000767        TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
XM_005256723.1      TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
NM_002756.4         TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
NM_145109.2         TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
XM_005256722.1      TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
                    ************************************************************

HsCD00000767        GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
XM_005256723.1      GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
NM_002756.4         GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
NM_145109.2         GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
XM_005256722.1      GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
                    ************************************************************

HsCD00000767        GAGATCCTGGGAGAAGACTCATGG
XM_005256723.1      GAGATCCTGGGAGAAGACTCATAG
NM_002756.4         GAGATCCTGGGAGAAGACTCATAG
NM_145109.2         GAGATCCTGGGAGAAGACTCATAG
XM_005256722.1      GAGATCCTGGGAGAAGACTCATAG
                    **********************.*

Pathways

NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Cellular roles of Anthrax toxin
NCI : IL12-mediated signaling events
NCI : RAC1 signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : RhoA signaling pathway
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling mediated by p38-gamma and p38-delta
NCI : TNF receptor signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : p38 MAPK signaling pathway
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Oxidative stress response
Panther : Ras Pathway
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK Cascade
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 20778
HIP Master Clone ID : 37124
Original Clone ID : FLH020778.01L

Organism


TAX_ID : 9606
Species Specific ID: 5606

Genome

Chromosome : 17
Map Location : 17q11.2
Ensembl : ENSG00000034152

Reagents

Labome : MKK3-antibody