DNASU Plasmid Repository • 480.965.5697 | Email

LDLR (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LDLR
Gene Name:  low density lipoprotein receptor
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH222334.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00076802

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2583nts         Open reading frame : 1 to 2583
Reference Sequence Alignment

ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
ACTGCAGTGGGCGACAGATGTGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
GGCGTCTCTTCCTATGACACCGTCATCAGCAGGGACATCCAGGCCCCCGACGGGCTGGCT
GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
AAACTTCACTCCATCTCAAGCATCGATGTCAATGGGGGCAACCGGAAGACCATCTTGGAG
GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTCCTCTTCCACAACCTCACCCAG
CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
ACAACCACCCGGCCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
TTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2653
Start on reference sequence 71
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LDLR
Symbol Nomenclature : LDLR
SYNONYM : FH; FHC; LDLCQ2
Designation : LDL receptor|low-density lipoprotein receptor|low-density lipoprotein receptor class A domain-containing protein 3
Full Nomenclature : low density lipoprotein receptor
GENEID : 3949
HGNC : 6547
MIM : 606945
Vega : OTTHUMG00000171935
Target GenBank: BC014514

 

Reference Sequence Alignment

  

HsCD00076802        ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_000527.4         ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_001195799.1      ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
NM_001195798.1      ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG
                    ************************************************************

HsCD00076802        ACTGCAGTGGGCGACAGATGTGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_000527.4         ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_001195799.1      ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
NM_001195798.1      ACTGCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC
                    ******************** ***************************************

HsCD00076802        TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_000527.4         TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_001195799.1      TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
NM_001195798.1      TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG
                    ************************************************************

HsCD00076802        GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
NM_000527.4         GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
NM_001195799.1      GAGACGT-----------------------------------------------------
NM_001195798.1      GAGACGTGCTTGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC
                    *******                                                     

HsCD00076802        CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
NM_000527.4         CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
NM_001195799.1      ------------------------------------------------------------
NM_001195798.1      CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC
                                                                                

HsCD00076802        GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_000527.4         GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_001195799.1      ----------GCTCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
NM_001195798.1      GAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG
                              *  ***********************************************

HsCD00076802        TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_000527.4         TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_001195799.1      TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
NM_001195798.1      TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG
                    ************************************************************

HsCD00076802        GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_000527.4         GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_001195799.1      GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
NM_001195798.1      GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC
                    ************************************************************

HsCD00076802        ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_000527.4         ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_001195799.1      ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
NM_001195798.1      ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG
                    ************************************************************

HsCD00076802        CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_000527.4         CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_001195799.1      CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
NM_001195798.1      CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC
                    ************************************************************

HsCD00076802        GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_000527.4         GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_001195799.1      GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
NM_001195798.1      GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC
                    ************************************************************

HsCD00076802        GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_000527.4         GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_001195799.1      GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
NM_001195798.1      GACTGCAAGGACAAATCTGACGAGGAAAACTGCGCTGTGGCCACCTGTCGCCCTGACGAA
                    ************************************************************

HsCD00076802        TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_000527.4         TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_001195799.1      TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
NM_001195798.1      TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC
                    ************************************************************

HsCD00076802        TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_000527.4         TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_001195799.1      TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
NM_001195798.1      TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGTGACACTCTGCGAGGGACCCAAC
                    ************************************************************

HsCD00076802        AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_000527.4         AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_001195799.1      AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
NM_001195798.1      AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA
                    ************************************************************

HsCD00076802        GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_000527.4         GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_001195799.1      GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
NM_001195798.1      GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCGGGACCAACGAATGCTTGGAC
                    ************************************************************

HsCD00076802        AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_000527.4         AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_001195799.1      AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
NM_001195798.1      AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC
                    ************************************************************

HsCD00076802        CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_000527.4         CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_001195799.1      CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
NM_001195798.1      CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGATATCGATGAGTGTCAGGAT
                    ************************************************************

HsCD00076802        CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_000527.4         CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_001195799.1      CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
NM_001195798.1      CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG
                    ************************************************************

HsCD00076802        GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_000527.4         GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_001195799.1      GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
NM_001195798.1      GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGCTCCATCGCCTAC
                    ************************************************************

HsCD00076802        CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_000527.4         CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_001195799.1      CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
NM_001195798.1      CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC
                    ************************************************************

HsCD00076802        AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_000527.4         AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_001195799.1      AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
NM_001195798.1      AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA
                    ************************************************************

HsCD00076802        ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_000527.4         ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_001195799.1      ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
NM_001195798.1      ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAGCACCCAGCTTGACAGAGCCCAC
                    ************************************************************

HsCD00076802        GGCGTCTCTTCCTATGACACCGTCATCAGCAGGGACATCCAGGCCCCCGACGGGCTGGCT
NM_000527.4         GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
NM_001195799.1      GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
NM_001195798.1      GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT
                    ********************************.***************************

HsCD00076802        GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_000527.4         GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_001195799.1      GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
NM_001195798.1      GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT
                    ************************************************************

HsCD00076802        GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_000527.4         GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_001195799.1      GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
NM_001195798.1      GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG
                    ************************************************************

HsCD00076802        GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_000527.4         GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_001195799.1      GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
NM_001195798.1      GCCATCGTGGTGGATCCTGTTCATGGCTTCATGTACTGGACTGACTGGGGAACTCCCGCC
                    ************************************************************

HsCD00076802        AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_000527.4         AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_001195799.1      AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
NM_001195798.1      AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT
                    ************************************************************

HsCD00076802        CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_000527.4         CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_001195799.1      CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
NM_001195798.1      CAGTGGCCCAATGGCATCACCCTAGATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC
                    ************************************************************

HsCD00076802        AAACTTCACTCCATCTCAAGCATCGATGTCAATGGGGGCAACCGGAAGACCATCTTGGAG
NM_000527.4         AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
NM_001195799.1      AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
NM_001195798.1      AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG
                    ******************************** ***************************

HsCD00076802        GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_000527.4         GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_001195799.1      GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
NM_001195798.1      GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAGGACAAAGTATTTTGG
                    ************************************************************

HsCD00076802        ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_000527.4         ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_001195799.1      ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
NM_001195798.1      ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC
                    ************************************************************

HsCD00076802        TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTCCTCTTCCACAACCTCACCCAG
NM_000527.4         TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
NM_001195799.1      TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
NM_001195798.1      TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG
                    ************************************** *********************

HsCD00076802        CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_000527.4         CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_001195799.1      CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
NM_001195798.1      CCAAGAGGAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG
                    ************************************************************

HsCD00076802        TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_000527.4         TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_001195799.1      TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
NM_001195798.1      TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC
                    ************************************************************

HsCD00076802        GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_000527.4         GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_001195799.1      GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
NM_001195798.1      GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAGAGGCTGAGGCTGCAGTGGCC
                    ************************************************************

HsCD00076802        ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_000527.4         ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_001195799.1      ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
NM_001195798.1      ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC
                    ************************************************************

HsCD00076802        ACAACCACCCGGCCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_000527.4         ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_001195799.1      ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
NM_001195798.1      ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC
                    ***********.************************************************

HsCD00076802        ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_000527.4         ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_001195799.1      ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
NM_001195798.1      ACGGTGGAGATAGTGACAATGTCTCACCAAGCTCTGGGCGACGTTGCTGGCAGAGGAAAT
                    ************************************************************

HsCD00076802        GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_000527.4         GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_001195799.1      GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
NM_001195798.1      GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCGTGCTCCTCGTC
                    ************************************************************

HsCD00076802        TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_000527.4         TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_001195799.1      TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
NM_001195798.1      TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC
                    ************************************************************

HsCD00076802        ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_000527.4         ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_001195799.1      ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
NM_001195798.1      ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC
                    ************************************************************

HsCD00076802        AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_000527.4         AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_001195799.1      AACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCG
NM_001195798.1      AACCAGGACGGCTACAGCTACCCCTCGATGGTCAG------TCTGGAGGATGACGTGGCG
                    **************************** . : *       *******************

HsCD00076802        TTG
NM_000527.4         TGA
NM_001195799.1      TGA
NM_001195798.1      TGA
                    * .

Pathways

Reactome : Chylomicron-mediated lipid transport
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : LDL-mediated lipid transport
Reactome : Lipid digestion, mobilization, and transport
Reactome : Lipoprotein metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Retinoid metabolism and transport
Reactome : Signal Transduction
Reactome : Visual phototransduction
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Folate Metabolism
WikiPathway : SREBF and miR33 in cholesterol and lipid homeostasis
WikiPathway : Selenium Pathway
WikiPathway : Statin Pathway
WikiPathway : Vitamin B12 Metabolism
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : LY : Low-density lipoprotein-receptor YWTD domain
SMART domain : EGF : Epidermal growth factor-like domain.
SMART domain : EGF_CA : Calcium-binding EGF-like domain
SMART domain : LDLa : Low-density lipoprotein receptor domain class A
UniProt : P01130
UniProt : B4DR00
UniProt : B4DTQ3
UniProt : B4DJZ8
UniProt : B4DII3
UniProt : Q59FQ1
HPRD : 06091

Clone

Cloning Information : 222334
HIP Master Clone ID : 138378
Original Clone ID : FLH222334.01L

Organism


TAX_ID : 9606
Species Specific ID: 3949

Genome

Chromosome : 19
Map Location : 19p13.2
Ensembl : ENSG00000130164

Reagents

Labome : LDLR-antibody