DNASU Plasmid Repository • 480.965.5697 | Email

MAPK13 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK13
Gene Name:  mitogen-activated protein kinase 13
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020467.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000769

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1098nts         Open reading frame : 1 to 1098
Reference Sequence Alignment

ATGAGCCTCATCCGGAAAAAGGGCTTCTACAAGCAGGACGTCAACAAGACAGCCTGGGAG
CTGCCCAAGACCTACGTGTCCCCGACGCACGTCGGCAGCGGGGCCTATGGCTCCGTGTGC
TCGGCCATCGACAAGCGGTCAGGGGAGAAGGTGGCCATCAAGAAGCTGAGCCGACCCTTT
CAGTCCGAGATCTTCGCCAAGCGCGCCTACCGGGAGCTGCTGCTGCTGAAGCACATGCAG
CATGAGAACGTCATTGGGCTCCTGGATGTCTTCACCCCAGCCTCCTCCCTGCGCAACTTC
TATGACTTCTACCTGGTGATGCCCTTCATGCAGACGGATCTGCAGAAGATCATGGGGATG
GAGTTCAGTGAGGAGAAGATCCAGTACCTGGTGTATCAGATGCTCAAAGGCCTTAAGTAC
ATCCACTCTGCTGGGGTCGTGCACAGGGACCTGAAGCCAGGCAACCTGGCTGTGAATGAG
GACTGTGAACTGAAGATTCTGGATTTTGGGCTGGCGCGACATGCAGACGCCGAGATGACT
GGCTACGTGGTGACCCGCTGGTACCGAGCCCCCGAGGTGATCCTCAGCTGGATGCACTAC
AACCAGACAGTGGACATCTGGTCTGTGGGCTGTATCATGGCAGAGATGCTGACAGGGAAA
ACTCTGTTCAAGGGGAAAGATTACCTGGACCAGCTGACCCAGATCCTGAAAGTGACCGGG
GTGCCTGGCACGGAGTTTGTGCAGAAGCTGAACGACAAAGCGGCCAAATCCTACATCCAG
TCCCTGCCACAGACCCCCAGGAAGGATTTCACTCAGCTGTTCCCACGGGCCAGCCCCCAG
GCTGCGGACCTGCTGGAGAAGATGCTGGAGCTAGACGTGGACAAGCGCCTGACGGCCGCG
CAGGCCCTCACCCATCCCTTCTTTGAACCCTTCCGGGACCCTGAGGAAGAGACGGAGGCC
CAGCAGCCGTTTGATGATTCCTTAGAACACGAGAAACTCACAGTGGATGAATGGAAGCAG
CACATCTACAAGGAGATTGTGAACTTCAGCCCCATTGCCCGGAAGGACTCACGGCGCCGG
AGTGGCATGAAGCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1120
Start on reference sequence 23
Mutations:
None
Discrepancy:
c51a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK13
Symbol Nomenclature : MAPK13
SYNONYM : MAPK 13; MAPK-13; PRKM13; SAPK4; p38delta
Designation : MAP kinase 13|MAP kinase p38 delta|mitogen-activated protein kinase p38 delta|stress-activated protein kinase 4
Full Nomenclature : mitogen-activated protein kinase 13
GENEID : 5603
Locus Tag : RP1-179N16.4
GI : 61366946
GenBank Accession : AY890996
HGNC : 6875
MIM : 602899
Vega : OTTHUMG00000014587
Target GenBank: NM_002754

 

Reference Sequence Alignment

  

HsCD00000769      ATGAGCCTCATCCGGAAAAAGGGCTTCTACAAGCAGGACGTCAACAAGACAGCCTGGGAG
NM_002754.4       ATGAGCCTCATCCGGAAAAAGGGCTTCTACAAGCAGGACGTCAACAAGACAGCCTGGGAG
                  ************************************************************

HsCD00000769      CTGCCCAAGACCTACGTGTCCCCGACGCACGTCGGCAGCGGGGCCTATGGCTCCGTGTGC
NM_002754.4       CTGCCCAAGACCTACGTGTCCCCGACGCACGTCGGCAGCGGGGCCTATGGCTCCGTGTGC
                  ************************************************************

HsCD00000769      TCGGCCATCGACAAGCGGTCAGGGGAGAAGGTGGCCATCAAGAAGCTGAGCCGACCCTTT
NM_002754.4       TCGGCCATCGACAAGCGGTCAGGGGAGAAGGTGGCCATCAAGAAGCTGAGCCGACCCTTT
                  ************************************************************

HsCD00000769      CAGTCCGAGATCTTCGCCAAGCGCGCCTACCGGGAGCTGCTGCTGCTGAAGCACATGCAG
NM_002754.4       CAGTCCGAGATCTTCGCCAAGCGCGCCTACCGGGAGCTGCTGCTGCTGAAGCACATGCAG
                  ************************************************************

HsCD00000769      CATGAGAACGTCATTGGGCTCCTGGATGTCTTCACCCCAGCCTCCTCCCTGCGCAACTTC
NM_002754.4       CATGAGAACGTCATTGGGCTCCTGGATGTCTTCACCCCAGCCTCCTCCCTGCGCAACTTC
                  ************************************************************

HsCD00000769      TATGACTTCTACCTGGTGATGCCCTTCATGCAGACGGATCTGCAGAAGATCATGGGGATG
NM_002754.4       TATGACTTCTACCTGGTGATGCCCTTCATGCAGACGGATCTGCAGAAGATCATGGGGATG
                  ************************************************************

HsCD00000769      GAGTTCAGTGAGGAGAAGATCCAGTACCTGGTGTATCAGATGCTCAAAGGCCTTAAGTAC
NM_002754.4       GAGTTCAGTGAGGAGAAGATCCAGTACCTGGTGTATCAGATGCTCAAAGGCCTTAAGTAC
                  ************************************************************

HsCD00000769      ATCCACTCTGCTGGGGTCGTGCACAGGGACCTGAAGCCAGGCAACCTGGCTGTGAATGAG
NM_002754.4       ATCCACTCTGCTGGGGTCGTGCACAGGGACCTGAAGCCAGGCAACCTGGCTGTGAATGAG
                  ************************************************************

HsCD00000769      GACTGTGAACTGAAGATTCTGGATTTTGGGCTGGCGCGACATGCAGACGCCGAGATGACT
NM_002754.4       GACTGTGAACTGAAGATTCTGGATTTTGGGCTGGCGCGACATGCAGACGCCGAGATGACT
                  ************************************************************

HsCD00000769      GGCTACGTGGTGACCCGCTGGTACCGAGCCCCCGAGGTGATCCTCAGCTGGATGCACTAC
NM_002754.4       GGCTACGTGGTGACCCGCTGGTACCGAGCCCCCGAGGTGATCCTCAGCTGGATGCACTAC
                  ************************************************************

HsCD00000769      AACCAGACAGTGGACATCTGGTCTGTGGGCTGTATCATGGCAGAGATGCTGACAGGGAAA
NM_002754.4       AACCAGACAGTGGACATCTGGTCTGTGGGCTGTATCATGGCAGAGATGCTGACAGGGAAA
                  ************************************************************

HsCD00000769      ACTCTGTTCAAGGGGAAAGATTACCTGGACCAGCTGACCCAGATCCTGAAAGTGACCGGG
NM_002754.4       ACTCTGTTCAAGGGGAAAGATTACCTGGACCAGCTGACCCAGATCCTGAAAGTGACCGGG
                  ************************************************************

HsCD00000769      GTGCCTGGCACGGAGTTTGTGCAGAAGCTGAACGACAAAGCGGCCAAATCCTACATCCAG
NM_002754.4       GTGCCTGGCACGGAGTTTGTGCAGAAGCTGAACGACAAAGCGGCCAAATCCTACATCCAG
                  ************************************************************

HsCD00000769      TCCCTGCCACAGACCCCCAGGAAGGATTTCACTCAGCTGTTCCCACGGGCCAGCCCCCAG
NM_002754.4       TCCCTGCCACAGACCCCCAGGAAGGATTTCACTCAGCTGTTCCCACGGGCCAGCCCCCAG
                  ************************************************************

HsCD00000769      GCTGCGGACCTGCTGGAGAAGATGCTGGAGCTAGACGTGGACAAGCGCCTGACGGCCGCG
NM_002754.4       GCTGCGGACCTGCTGGAGAAGATGCTGGAGCTAGACGTGGACAAGCGCCTGACGGCCGCG
                  ************************************************************

HsCD00000769      CAGGCCCTCACCCATCCCTTCTTTGAACCCTTCCGGGACCCTGAGGAAGAGACGGAGGCC
NM_002754.4       CAGGCCCTCACCCATCCCTTCTTTGAACCCTTCCGGGACCCTGAGGAAGAGACGGAGGCC
                  ************************************************************

HsCD00000769      CAGCAGCCGTTTGATGATTCCTTAGAACACGAGAAACTCACAGTGGATGAATGGAAGCAG
NM_002754.4       CAGCAGCCGTTTGATGATTCCTTAGAACACGAGAAACTCACAGTGGATGAATGGAAGCAG
                  ************************************************************

HsCD00000769      CACATCTACAAGGAGATTGTGAACTTCAGCCCCATTGCCCGGAAGGACTCACGGCGCCGG
NM_002754.4       CACATCTACAAGGAGATTGTGAACTTCAGCCCCATTGCCCGGAAGGACTCACGGCGCCGG
                  ************************************************************

HsCD00000769      AGTGGCATGAAGCTGTTG
NM_002754.4       AGTGGCATGAAGCTGTAG
                  ****************:*

Pathways

NCI : Signaling mediated by p38-gamma and p38-delta
Panther : Alzheimer disease-amyloid secretase pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Panther : Oxidative stress response
Panther : Ras Pathway
Panther : TGF-beta signaling pathway
Panther : p38 MAPK pathway
Panther : p53 pathway feedback loops 2
Reactome : Cell-Cell communication
Reactome : DSCAM interactions
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : p38MAPK events
WikiPathway : Insulin Signaling
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 20467
HIP Master Clone ID : 36813
Original Clone ID : FLH020467.01L

Organism


TAX_ID : 9606
Species Specific ID: 5603

Genome

Chromosome : 6
Map Location : 6p21.31
Ensembl : ENSG00000156711

Reagents

Labome : MAPK13-antibody