DNASU Plasmid Repository • 480.965.5697 | Email

MAPK10 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK10
Gene Name:  mitogen-activated protein kinase 10
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020610.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000770

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1269nts         Open reading frame : 1 to 1269
Reference Sequence Alignment

ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGCACAGGTG
CAGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1492
Start on reference sequence 224
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK10
Symbol Nomenclature : MAPK10
SYNONYM : JNK3; JNK3A; PRKM10; RP13-514E23.1; SAPK1b; p493F12; p54bSAPK
Designation : JNK3 alpha protein kinase|MAP kinase 10|MAP kinase p49 3F12|MAPK 10|c-Jun N-terminal kinase 3|stress activated protein kinase beta|stress-activated protein kinase 1b|stress-activated protein kinase JNK3
Full Nomenclature : mitogen-activated protein kinase 10
GENEID : 5602
GI : 61366952
GenBank Accession : AY890997
HGNC : 6872
MIM : 602897
Vega : OTTHUMG00000130604
Target GenBank: NM_002753

 

Reference Sequence Alignment

  

HsCD00000770        ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
XM_005263129.1      ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
NM_139046.2         ------------------------------------------------------------
XM_005263130.1      ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
NM_002750.3         ------------------------------------------------------------
NM_138980.2         ------------------------------------------------------------
NM_001278547.1      ------------------------------------------------------------
NM_139049.2         ------------------------------------------------------------
NM_138982.2         ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
NM_002753.3         ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACATTGGATGTGAAAATTGCCTTT
                                                                                

HsCD00000770        TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
XM_005263129.1      TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
NM_139046.2         ------------------------------------------------------ATGAGC
XM_005263130.1      TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
NM_002750.3         ------------------------------------------------------ATGAGC
NM_138980.2         ------------------------------------------------------ATGAGC
NM_001278547.1      ------------------------------------------------------ATGAGC
NM_139049.2         ------------------------------------------------------ATGAGC
NM_138982.2         TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
NM_002753.3         TGTCAGGGATTCGATAAACAAGTGGATGTGTCATATATTGCCAAACATTACAACATGAGC
                                                                          ******

HsCD00000770        AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
XM_005263129.1      AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_139046.2         AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
XM_005263130.1      AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_002750.3         AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
NM_138980.2         AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_001278547.1      AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
NM_139049.2         AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC
NM_138982.2         AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
NM_002753.3         AAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTT
                    *.******.  *******.* ** ** *****.**..* ***** **:**.******** 

HsCD00000770        CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
XM_005263129.1      CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_139046.2         CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
XM_005263130.1      CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_002750.3         CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
NM_138980.2         CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_001278547.1      CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
NM_139049.2         CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA
NM_138982.2         CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
NM_002753.3         CTCAAGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCC
                    ** **.**.** ****** ****.*****:*****:**.*****.**.*****:** **.

HsCD00000770        GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
XM_005263129.1      GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_139046.2         GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
XM_005263130.1      GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_002750.3         GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
NM_138980.2         GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_001278547.1      GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
NM_139049.2         GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG
NM_138982.2         GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
NM_002753.3         GCGTATGATGCTGTCCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAG
                    ** ******** .* *****.******** **.** ********.***.****.******

HsCD00000770        AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
XM_005263129.1      AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_139046.2         AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
XM_005263130.1      AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_002750.3         AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
NM_138980.2         AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_001278547.1      AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
NM_139049.2         AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC
NM_138982.2         AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
NM_002753.3         AACCAAACACATGCCAAGAGAGCGTACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCAT
                    ** **.**:*********.*.** ***.*.*****.** ** *****.***** ** ** 

HsCD00000770        AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
XM_005263129.1      AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_139046.2         AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
XM_005263130.1      AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_002750.3         AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
NM_138980.2         AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_001278547.1      AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
NM_139049.2         AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA
NM_138982.2         AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
NM_002753.3         AAAAACATTATTAGTTTATTAAATGTCTTCACACCCCAGAAAACGCTGGAGGAGTTCCAA
                    ***** **:***.*  *:**.***** ********.******:* **.**.**.** ***

HsCD00000770        GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
XM_005263129.1      GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_139046.2         GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
XM_005263130.1      GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_002750.3         GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
NM_138980.2         GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_001278547.1      GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
NM_139049.2         GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG
NM_138982.2         GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
NM_002753.3         GATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCAAGTGATTCAGATGGAA
                    *********:****.*****.** ********.**  *:** *****************.

HsCD00000770        TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
XM_005263129.1      TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_139046.2         CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
XM_005263130.1      TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_002750.3         CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
NM_138980.2         TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_001278547.1      CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
NM_139049.2         CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT
NM_138982.2         TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
NM_002753.3         TTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAGCACCTC
                     **** *****..******* ***** ** ** **.*** *******.** ******** 

HsCD00000770        CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
XM_005263129.1      CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_139046.2         CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
XM_005263130.1      CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_002750.3         CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
NM_138980.2         CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_001278547.1      CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
NM_139049.2         CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT
NM_138982.2         CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
NM_002753.3         CATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGAT
                    ******************** .**** *****.**.***** **:*****.**.******

HsCD00000770        TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
XM_005263129.1      TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_139046.2         TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
XM_005263130.1      TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_002750.3         TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
NM_138980.2         TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_001278547.1      TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
NM_139049.2         TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG
NM_138982.2         TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
NM_002753.3         TGCACATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATG
                    *****:*****.** ** ***** **:***********:*****.**.** ** ******

HsCD00000770        ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
XM_005263129.1      ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_139046.2         ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
XM_005263130.1      ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_002750.3         ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
NM_138980.2         ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_001278547.1      ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
NM_139049.2         ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC
NM_138982.2         ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
NM_002753.3         ACTCCATATGTGGTGACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTAC
                    ** **:*****.*****:** ** ********.** *********** ** *********

HsCD00000770        AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
XM_005263129.1      AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_139046.2         AAGGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGT
XM_005263130.1      AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_002750.3         AAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAA
NM_138980.2         AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_001278547.1      AAGGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGT
NM_139049.2         AAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAA
NM_138982.2         AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
NM_002753.3         AAGGAGAACGTGGATATATGGTCTGTGGGATGCATTATGGGAGAAATGGTTCGCCACAAA
                    *****.***** ** :*:*****:** **.***** ************.*  .. . ..:

HsCD00000770        ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
XM_005263129.1      ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_139046.2         GTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
XM_005263130.1      ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_002750.3         ATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
NM_138980.2         ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_001278547.1      GTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
NM_139049.2         ATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGA
NM_138982.2         ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
NM_002753.3         ATCCTCTTTCCAGGAAGGGACTATATTGACCAGTGGAATAAGGTAATTGAACAACTAGGA
                    .*  * ** *****:* .**  ******* ***********.**:********.**:***

HsCD00000770        ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
XM_005263129.1      ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_139046.2         ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
XM_005263130.1      ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_002750.3         ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
NM_138980.2         ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_001278547.1      ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
NM_139049.2         ACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAAC
NM_138982.2         ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
NM_002753.3         ACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAGAAACTATGTGGAGAAT
                    ***********:*************** *******.********.*. ** ** **.** 

HsCD00000770        CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
XM_005263129.1      CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_139046.2         AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
XM_005263130.1      CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_002750.3         AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
NM_138980.2         CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_001278547.1      AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
NM_139049.2         AGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCT
NM_138982.2         CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
NM_002753.3         CGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTCCCAGCG
                    .*.** **.***** *** : * ***  . ***********:***  *** ******** 

HsCD00000770        GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
XM_005263129.1      GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_139046.2         GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
XM_005263130.1      GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_002750.3         GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
NM_138980.2         GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_001278547.1      GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
NM_139049.2         GACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTG
NM_138982.2         GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
NM_002753.3         GACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTA
                    *****.**.***** ***** ******** **.**.***** *****.**.**.*****.

HsCD00000770        GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
XM_005263129.1      GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_139046.2         GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
XM_005263130.1      GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_002750.3         GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
NM_138980.2         GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_001278547.1      GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
NM_139049.2         GTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAAT
NM_138982.2         GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
NM_002753.3         GTGATTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAAC
                    **.**:**  ** *:*****.**.**:**.** **.**  *.**.** ** ******** 

HsCD00000770        GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
XM_005263129.1      GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_139046.2         GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
XM_005263130.1      GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_002750.3         GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
NM_138980.2         GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_001278547.1      GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
NM_139049.2         GTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTA
NM_138982.2         GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
NM_002753.3         GTCTGGTATGACCCAGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTG
                    *********** **: * **** .**.** **:*****:.****. .************.

HsCD00000770        GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
XM_005263129.1      GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_139046.2         GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
XM_005263130.1      GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_002750.3         GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
NM_138980.2         GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_001278547.1      GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
NM_139049.2         GATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGAC
NM_138982.2         GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
NM_002753.3         GATGAAAGAGAACACACAATTGAAGAATGGAAAGAACTTATCTACAAGGAAGTAATGAAT
                    ********.***********:*****.********* * **.** ********:***.* 

HsCD00000770        TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGCACAGGTG
XM_005263129.1      TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_139046.2         TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTG
XM_005263130.1      TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_002750.3         TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTG
NM_138980.2         TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_001278547.1      TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCA
NM_139049.2         TTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCA
NM_138982.2         TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGGTGCAGCA
NM_002753.3         TCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAGGACAGCCTTCTCCTTCAGCACAGGTG
                    * .**.**.*..** **.*****:**:.**...**.***** ******* ** : ..* .

HsCD00000770        CAGCAGTTG---------------------------------------------------
XM_005263129.1      GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_139046.2         CAGCAGTGA---------------------------------------------------
XM_005263130.1      GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_002750.3         CAGCAGTGA---------------------------------------------------
NM_138980.2         GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_001278547.1      GTGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATG
NM_139049.2         GTGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATG
NM_138982.2         GTGAACAGCAGTGAGAG---TCTCCCTCCATCCTCGTCTGTCAATGACATCTCCTCCATG
NM_002753.3         CAGCAGTGA---------------------------------------------------
                     :*.: :                                                     

HsCD00000770        ------------------------------------------------------------
XM_005263129.1      TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_139046.2         ------------------------------------------------------------
XM_005263130.1      TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_002750.3         ------------------------------------------------------------
NM_138980.2         TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_001278547.1      TCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCT
NM_139049.2         TCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCT
NM_138982.2         TCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGACCC
NM_002753.3         ------------------------------------------------------------
                                                                                

HsCD00000770        ------------------
XM_005263129.1      CTGGGTTGTTGCAGGTGA
NM_139046.2         ------------------
XM_005263130.1      CTGGGTTGTTGCAGGTGA
NM_002750.3         ------------------
NM_138980.2         CTGGGTTGTTGCAGGTGA
NM_001278547.1      CTGGGCTGCTGTAGATGA
NM_139049.2         CTGGGCTGCTGTAGATGA
NM_138982.2         CTGGGTTGTTGCAGGTGA
NM_002753.3         ------------------
                                      

Pathways

NCI : CD40/CD40L signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FoxO family signaling
NCI : Glucocorticoid receptor regulatory network
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Noncanonical Wnt signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FAS signaling pathway
Panther : FGF signaling pathway
Panther : Integrin signalling pathway
Panther : Interferon-gamma signaling pathway
Panther : Parkinson disease
Panther : Ras Pathway
Panther : TGF-beta signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of the AP-1 family of transcription factors
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G13 Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Oxidative Stress
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : TyrKc : Tyrosine kinase, catalytic domain
SMART domain : S_TKc : Serine/Threonine protein kinases, catalytic domain
UniProt : A8MWR3
UniProt : B3KQ94
UniProt : A6NG28
UniProt : P53779
HPRD : 04207

Clone

Cloning Information : 20610
HIP Master Clone ID : 36956
Original Clone ID : FLH020610.01L

Organism


TAX_ID : 9606
Species Specific ID: 5602

Genome

Chromosome : 4
Map Location : 4q22.1-q23
Ensembl : ENSG00000109339

Reagents

Labome : MAPK10-antibody