DNASU Plasmid Repository • 480.965.5697 | Email

GSK3A (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GSK3A
Gene Name:  glycogen synthase kinase 3 alpha
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH222488.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: This clone is identical to HsCD00620881.
Mutation/
Discrepancy :
No / No
Publications: PMID: 25187516
Title: Mycobacterium tuberculosis Promotes Anti-Apoptotic Activity of the Macrophage by PtpA-Dependent Dephosphorylation of Host GSK3a
Authors:
HsCD00077034

Price:  Login for Pricing
UNAVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1452nts         Open reading frame : 1 to 1452
Reference Sequence Alignment

ATGAGCGGCGGCGGGCCTTCGGGAGGCGGCCCTGGGGGCTCGGGCAGGGCGCGGACTAGC
TCGTTCGCGGAGCCCGGCGGCGGAGGCGGAGGAGGCGGCGGCGGCCCCGGAGGCTCGGCC
TCCGGCCCAGGCGGCACCGGCGGCGGAAAGGCATCTGTCGGGGCCATGGGTGGGGGCGTC
GGGGCCTCGAGCTCCGGGGGTGGACCCGGCGGCAGCGGCGGAGGAGGCAGCGGAGGCCCC
GGCGCAGGCACTAGCTTCCCGCCGCCCGGGGTGAAGCTGGGCCGTGACAGCGGGAAGGTG
ACCACAGTCGTAGCCACTCTAGGCCAAGGCCCAGAGCGCTCCCAAGAAGTGGCTTACACG
GACATCAAAGTGATTGGCAATGGCTCATTTGGGGTCGTGTACCAGGCACGGCTGGCAGAG
ACCAGGGAACTAGTCGCCATCAAGAAGGTTCTCCAGGACAAGAGGTTCAAGAACCGAGAG
CTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGTGAGGCTGAGATACTTTTTCTAC
TCCAGTGGCGAGAAGAAAGACGAGCTTTACCTAAATCTGGTGCTGGAATATGTGCCCGAG
ACAGTGTACCGGGTGGCCCGCCACTTCACCAAGGCCAAGTTGACCATCCCTATCCTCTAT
GTCAAGGTGTACATGTACCAGCTCTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTG
TGTCACCGCGACATCAAGCCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAG
CTCTGCGATTTTGGCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATC
TGTTCTCGCTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCC
ATCGATGTTTGGTCAGCTGGCTGTGTACTGGCAGAGCTCCTCTTGGGCCAGCCCATCTTC
CCTGGGGACAGTGGGGTGGACCAGCTGGTGGAGATCATCAAGGTGCTGGGAACACCAACC
CGGGAACAAATCCGAGAGATGAACCCCAACTACACGGAGTTCAAGTTCCCTCAGATTAAA
GCTCACCCCTGGACAAAGGTGTTCAAATCTCGAACGCCGCCAGAGGCCATCGCGCTCTGC
TCTAGCCTGCTGGAGTACACCCCATCCTCAAGGCTCTCCCCACTAGAGGCCTGTGCGCAC
AGCTTCTTTGATGAACTGCGATGTCTGGGAACCCAGCTGCCTAACAACCGCCCACTTCCC
CCTCTCTTCAACTTCAGTGCTGGTGAACTCTCCATCCAACCGTCTCTCAACGCCATTCTC
ATCCCTCCTCACTTGAGGTCCCCAGCGGGCACTACCACCCTCACCCCGTCCTCACAAGCT
TTAACTGAGACTCCGACCAGCTCAGACTGGCAGTCGACCGATGCCACACCTACCCTCACT
AACTCCTCCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1590
Start on reference sequence 139
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GSK3A
Symbol Nomenclature : GSK3A
Designation : GSK-3 alpha|glycogen synthase kinase-3 alpha|serine/threonine-protein kinase GSK3A
Full Nomenclature : glycogen synthase kinase 3 alpha
GENEID : 2931
HGNC : 4616
MIM : 606784
Vega : OTTHUMG00000150722
Target GenBank: BC027984

 

Reference Sequence Alignment

  

HsCD00077034      ATGAGCGGCGGCGGGCCTTCGGGAGGCGGCCCTGGGGGCTCGGGCAGGGCGCGGACTAGC
NM_019884.2       ATGAGCGGCGGCGGGCCTTCGGGAGGCGGCCCTGGGGGCTCGGGCAGGGCGCGGACTAGC
                  ************************************************************

HsCD00077034      TCGTTCGCGGAGCCCGGCGGCGGAGGCGGAGGAGGCGGCGGCGGCCCCGGAGGCTCGGCC
NM_019884.2       TCGTTCGCGGAGCCCGGCGGCGGAGGCGGAGGAGGCGGCGGCGGCCCCGGAGGCTCGGCC
                  ************************************************************

HsCD00077034      TCCGGCCCAGGCGGCACCGGCGGCGGAAAGGCATCTGTCGGGGCCATGGGTGGGGGCGTC
NM_019884.2       TCCGGCCCAGGCGGCACCGGCGGCGGAAAGGCATCTGTCGGGGCCATGGGTGGGGGCGTC
                  ************************************************************

HsCD00077034      GGGGCCTCGAGCTCCGGGGGTGGACCCGGCGGCAGCGGCGGAGGAGGCAGCGGAGGCCCC
NM_019884.2       GGGGCCTCGAGCTCCGGGGGTGGACCCGGCGGCAGCGGCGGAGGAGGCAGCGGAGGCCCC
                  ************************************************************

HsCD00077034      GGCGCAGGCACTAGCTTCCCGCCGCCCGGGGTGAAGCTGGGCCGTGACAGCGGGAAGGTG
NM_019884.2       GGCGCAGGCACTAGCTTCCCGCCGCCCGGGGTGAAGCTGGGCCGTGACAGCGGGAAGGTG
                  ************************************************************

HsCD00077034      ACCACAGTCGTAGCCACTCTAGGCCAAGGCCCAGAGCGCTCCCAAGAAGTGGCTTACACG
NM_019884.2       ACCACAGTCGTAGCCACTCTAGGCCAAGGCCCAGAGCGCTCCCAAGAAGTGGCTTACACG
                  ************************************************************

HsCD00077034      GACATCAAAGTGATTGGCAATGGCTCATTTGGGGTCGTGTACCAGGCACGGCTGGCAGAG
NM_019884.2       GACATCAAAGTGATTGGCAATGGCTCATTTGGGGTCGTGTACCAGGCACGGCTGGCAGAG
                  ************************************************************

HsCD00077034      ACCAGGGAACTAGTCGCCATCAAGAAGGTTCTCCAGGACAAGAGGTTCAAGAACCGAGAG
NM_019884.2       ACCAGGGAACTAGTCGCCATCAAGAAGGTTCTCCAGGACAAGAGGTTCAAGAACCGAGAG
                  ************************************************************

HsCD00077034      CTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGTGAGGCTGAGATACTTTTTCTAC
NM_019884.2       CTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGTGAGGCTGAGATACTTTTTCTAC
                  ************************************************************

HsCD00077034      TCCAGTGGCGAGAAGAAAGACGAGCTTTACCTAAATCTGGTGCTGGAATATGTGCCCGAG
NM_019884.2       TCCAGTGGCGAGAAGAAAGACGAGCTTTACCTAAATCTGGTGCTGGAATATGTGCCCGAG
                  ************************************************************

HsCD00077034      ACAGTGTACCGGGTGGCCCGCCACTTCACCAAGGCCAAGTTGACCATCCCTATCCTCTAT
NM_019884.2       ACAGTGTACCGGGTGGCCCGCCACTTCACCAAGGCCAAGTTGACCATCCCTATCCTCTAT
                  ************************************************************

HsCD00077034      GTCAAGGTGTACATGTACCAGCTCTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTG
NM_019884.2       GTCAAGGTGTACATGTACCAGCTCTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTG
                  ************************************************************

HsCD00077034      TGTCACCGCGACATCAAGCCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAG
NM_019884.2       TGTCACCGCGACATCAAGCCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAG
                  ************************************************************

HsCD00077034      CTCTGCGATTTTGGCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATC
NM_019884.2       CTCTGCGATTTTGGCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATC
                  ************************************************************

HsCD00077034      TGTTCTCGCTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCC
NM_019884.2       TGTTCTCGCTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCC
                  ************************************************************

HsCD00077034      ATCGATGTTTGGTCAGCTGGCTGTGTACTGGCAGAGCTCCTCTTGGGCCAGCCCATCTTC
NM_019884.2       ATCGATGTTTGGTCAGCTGGCTGTGTACTGGCAGAGCTCCTCTTGGGCCAGCCCATCTTC
                  ************************************************************

HsCD00077034      CCTGGGGACAGTGGGGTGGACCAGCTGGTGGAGATCATCAAGGTGCTGGGAACACCAACC
NM_019884.2       CCTGGGGACAGTGGGGTGGACCAGCTGGTGGAGATCATCAAGGTGCTGGGAACACCAACC
                  ************************************************************

HsCD00077034      CGGGAACAAATCCGAGAGATGAACCCCAACTACACGGAGTTCAAGTTCCCTCAGATTAAA
NM_019884.2       CGGGAACAAATCCGAGAGATGAACCCCAACTACACGGAGTTCAAGTTCCCTCAGATTAAA
                  ************************************************************

HsCD00077034      GCTCACCCCTGGACAAAGGTGTTCAAATCTCGAACGCCGCCAGAGGCCATCGCGCTCTGC
NM_019884.2       GCTCACCCCTGGACAAAGGTGTTCAAATCTCGAACGCCGCCAGAGGCCATCGCGCTCTGC
                  ************************************************************

HsCD00077034      TCTAGCCTGCTGGAGTACACCCCATCCTCAAGGCTCTCCCCACTAGAGGCCTGTGCGCAC
NM_019884.2       TCTAGCCTGCTGGAGTACACCCCATCCTCAAGGCTCTCCCCACTAGAGGCCTGTGCGCAC
                  ************************************************************

HsCD00077034      AGCTTCTTTGATGAACTGCGATGTCTGGGAACCCAGCTGCCTAACAACCGCCCACTTCCC
NM_019884.2       AGCTTCTTTGATGAACTGCGATGTCTGGGAACCCAGCTGCCTAACAACCGCCCACTTCCC
                  ************************************************************

HsCD00077034      CCTCTCTTCAACTTCAGTGCTGGTGAACTCTCCATCCAACCGTCTCTCAACGCCATTCTC
NM_019884.2       CCTCTCTTCAACTTCAGTGCTGGTGAACTCTCCATCCAACCGTCTCTCAACGCCATTCTC
                  ************************************************************

HsCD00077034      ATCCCTCCTCACTTGAGGTCCCCAGCGGGCACTACCACCCTCACCCCGTCCTCACAAGCT
NM_019884.2       ATCCCTCCTCACTTGAGGTCCCCAGCGGGCACTACCACCCTCACCCCGTCCTCACAAGCT
                  ************************************************************

HsCD00077034      TTAACTGAGACTCCGACCAGCTCAGACTGGCAGTCGACCGATGCCACACCTACCCTCACT
NM_019884.2       TTAACTGAGACTCCGACCAGCTCAGACTGGCAGTCGACCGATGCCACACCTACCCTCACT
                  ************************************************************

HsCD00077034      AACTCCTCCTTG
NM_019884.2       AACTCCTCCTGA
                  ********** .

Pathways

NCI : Canonical Wnt signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Degradation of beta catenin
NCI : FOXM1 transcription factor network
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : PDGF signaling pathway
Panther : Ras Pathway
Reactome : AKT phosphorylates targets in the cytosol
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IRE1alpha activates chaperones
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Metabolism of proteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Unfolded Protein Response (UPR)
Reactome : XBP1(S) activates chaperone genes
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Glycogen Metabolism
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrated Breast Cancer Pathway

Clone

Cloning Information : 222488
HIP Master Clone ID : 141994
Original Clone ID : FLH222488.01L

Organism


TAX_ID : 9606
Species Specific ID: 2931

Genome

Chromosome : 19
Map Location : 19q13.2
Ensembl : ENSG00000105723

Reagents

Labome : GSK3-antibody