DNASU Plasmid Repository • 480.965.5697 | Email

TRAF6 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TRAF6
Gene Name:  TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH222672.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00077278

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1569nts         Open reading frame : 1 to 1569
Reference Sequence Alignment

ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATTCAGCCAGTCTGAAAGTGACTGCTGT
GTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCC
AGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTT
GACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCA
GTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT
GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGAC
AATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTG
CACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATG
GATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAG
GATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT
AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACT
ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
GTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTT
GGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTC
TACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT
CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGC
CACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCA
CCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAG
CGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAA
GCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC
ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCA
GGGGTATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1895
Start on reference sequence 327
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TRAF6
Symbol Nomenclature : TRAF6
SYNONYM : MGC:3310; RNF85
Designation : E3 ubiquitin-protein ligase TRAF6|RING finger protein 85|TNF receptor-associated factor 6|interleukin-1 signal transducer
Full Nomenclature : TNF receptor-associated factor 6, E3 ubiquitin protein ligase
GENEID : 7189
HGNC : 12036
MIM : 602355
Target GenBank: BC031052

 

Reference Sequence Alignment

  

HsCD00077278      ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATTCAGCCAGTCTGAAAGTGACTGCTGT
NM_004620.3       ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTGCTGT
NM_145803.2       ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTGCTGT
                  ********************************** *************************

HsCD00077278      GTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCC
NM_004620.3       GTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCC
NM_145803.2       GTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCC
                  ************************************************************

HsCD00077278      AGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTT
NM_004620.3       AGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTT
NM_145803.2       AGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTT
                  ************************************************************

HsCD00077278      GACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCA
NM_004620.3       GACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCA
NM_145803.2       GACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCA
                  ************************************************************

HsCD00077278      GTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT
NM_004620.3       GTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT
NM_145803.2       GTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGAT
                  ************************************************************

HsCD00077278      GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGAC
NM_004620.3       GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGAC
NM_145803.2       GCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGAC
                  ************************************************************

HsCD00077278      AATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTG
NM_004620.3       AATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTG
NM_145803.2       AATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTG
                  ************************************************************

HsCD00077278      CACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATG
NM_004620.3       CACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATG
NM_145803.2       CACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATG
                  ************************************************************

HsCD00077278      GATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAG
NM_004620.3       GATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAG
NM_145803.2       GATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAG
                  ************************************************************

HsCD00077278      GATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT
NM_004620.3       GATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT
NM_145803.2       GATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGAT
                  ************************************************************

HsCD00077278      AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACT
NM_004620.3       AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACT
NM_145803.2       AAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACT
                  ************************************************************

HsCD00077278      ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
NM_004620.3       ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
NM_145803.2       ATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATT
                  ************************************************************

HsCD00077278      CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
NM_004620.3       CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
NM_145803.2       CCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGC
                  ************************************************************

HsCD00077278      CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
NM_004620.3       CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
NM_145803.2       CACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTG
                  ************************************************************

HsCD00077278      AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
NM_004620.3       AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
NM_145803.2       AGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCAC
                  ************************************************************

HsCD00077278      CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
NM_004620.3       CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
NM_145803.2       CAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATG
                  ************************************************************

HsCD00077278      GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
NM_004620.3       GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
NM_145803.2       GAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAA
                  ************************************************************

HsCD00077278      GTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTT
NM_004620.3       GTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTT
NM_145803.2       GTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTT
                  ************************************************************

HsCD00077278      GGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTC
NM_004620.3       GGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTC
NM_145803.2       GGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTC
                  ************************************************************

HsCD00077278      TACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT
NM_004620.3       TACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT
NM_145803.2       TACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCT
                  ************************************************************

HsCD00077278      CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGC
NM_004620.3       CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGC
NM_145803.2       CAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGC
                  ************************************************************

HsCD00077278      CACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCA
NM_004620.3       CACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCA
NM_145803.2       CACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCA
                  ************************************************************

HsCD00077278      CCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAG
NM_004620.3       CCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAG
NM_145803.2       CCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAG
                  ************************************************************

HsCD00077278      CGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAA
NM_004620.3       CGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAA
NM_145803.2       CGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAA
                  ************************************************************

HsCD00077278      GCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC
NM_004620.3       GCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC
NM_145803.2       GCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCC
                  ************************************************************

HsCD00077278      ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCA
NM_004620.3       ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCA
NM_145803.2       ACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCA
                  ************************************************************

HsCD00077278      GGGGTATTG
NM_004620.3       GGGGTATAG
NM_145803.2       GGGGTATAG
                  *******:*

Pathways

NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : Canonical NF-kappaB pathway
NCI : IL1-mediated signaling events
NCI : Regulation of p38-alpha and p38-beta
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : p38 MAPK signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : Toll receptor signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Adaptive Immune System
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cytokine Signaling in Immune system
Reactome : Downstream TCR signaling
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IKK complex recruitment mediated by RIP1
Reactome : IRAK1 recruits IKK complex
Reactome : IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NF-kB is activated and signals survival
Reactome : NOD1/2 Signaling Pathway
Reactome : NRIF signals cell death from the nucleus
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulated proteolysis of p75NTR
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signalling by NGF
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TCR signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-1 signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : MATH : meprin and TRAF homology
SMART domain : RING : Ring finger
UniProt : Q9Y4K3
HPRD : 03833

Clone

Cloning Information : 222672
HIP Master Clone ID : 143638
Original Clone ID : FLH222672.01L

Organism


TAX_ID : 9606
Species Specific ID: 7189

Genome

Chromosome : 11
Map Location : 11p12

Reagents

Labome : TRAF6-antibody