DNASU Plasmid Repository • 480.965.5697 | Email

RPA2 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA2
Gene Name:  replication protein A2, 32kDa
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH225499.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00078624

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 813nts         Open reading frame : 1 to 813
Reference Sequence Alignment

ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGGGGAGCCGGCGGCTAC
ACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAATCAAGA
GCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTT
GATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATC
AGACATGCAGAGAAGGCTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCA
CCCATGGACGTTCGCCAGTGGGTTGACACAGATGACACCAGCAGTGAAAACACTGTGGTT
CCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTGAGATCTTTTCAGAACAAAAAGAGC
CTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCACCACACATATTCTG
GAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGGGAGA
GCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATG
CCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCA
AGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCC
TCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGGAT
GATGACCATTTTAAATCCACAGATGCAGAATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 904
Start on reference sequence 92
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA2
Symbol Nomenclature : RPA2
SYNONYM : REPA2; RPA32
Designation : RF-A protein 2|RP-A p32|RP-A p34|replication factor A protein 2|replication protein A 32 kDa subunit|replication protein A 34 kDa subunit
Full Nomenclature : replication protein A2, 32kDa
GENEID : 6118
Locus Tag : RP4-547C9.3
HGNC : 10290
MIM : 179836
Vega : OTTHUMG00000003915
Target GenBank: BC001630

 

Reference Sequence Alignment

  

HsCD00078624        ------------------------ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCC
XM_005245965.1      ATGGGCAGAGGAGACAGGAACAAGCGTAGCATCCGTGGATTCGAAAGCTATGGCAGCTCC
NM_002946.4         ------------------------ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCC
                                            .  :* *:*.**************************

HsCD00078624        TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
XM_005245965.1      TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
NM_002946.4         TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
                    ************************************************************

HsCD00078624        TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
XM_005245965.1      TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
NM_002946.4         TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
                    ************************************************************

HsCD00078624        CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
XM_005245965.1      CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
NM_002946.4         CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
                    ************************************************************

HsCD00078624        CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
XM_005245965.1      CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
NM_002946.4         CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
                    ************************************************************

HsCD00078624        AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
XM_005245965.1      AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
NM_002946.4         AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
                    ************************************************************

HsCD00078624        ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
XM_005245965.1      ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
NM_002946.4         ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
                    ************************************************************

HsCD00078624        AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
XM_005245965.1      AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
NM_002946.4         AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
                    ************************************************************

HsCD00078624        AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
XM_005245965.1      AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
NM_002946.4         AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
                    ************************************************************

HsCD00078624        AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
XM_005245965.1      AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
NM_002946.4         AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
                    ************************************************************

HsCD00078624        AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
XM_005245965.1      AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
NM_002946.4         AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
                    ************************************************************

HsCD00078624        TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
XM_005245965.1      TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
NM_002946.4         TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
                    ************************************************************

HsCD00078624        CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
XM_005245965.1      CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
NM_002946.4         CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
                    ************************************************************

HsCD00078624        GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATTG
XM_005245965.1      GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA
NM_002946.4         GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA
                    *******************************************************:.

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : miRNA regulation of DNA Damage Response

Protein

UniProt : P15927
HPRD : 01566

Clone

Cloning Information : 225499
HIP Master Clone ID : 162915
Original Clone ID : FLH225499.01L

Organism


TAX_ID : 9606
Species Specific ID: 6118

Genome

Chromosome : 1
Map Location : 1p35
Ensembl : ENSG00000117748

Reagents

Labome : RPA2-antibody