DNASU Plasmid Repository • 480.965.5697 | Email

RFC4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RFC4
Gene Name:  replication factor C (activator 1) 4, 37kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007191.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000794

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1092nts         Open reading frame : 1 to 1092
Reference Sequence Alignment

ATGCAAGCATTTCTTAAAGGTACATCCATCAGTACTAAACCCCCGCTGACCAAGGATCGA
GGAGTAGCTGCCAGTGCGGGAAGTAGCGGAGAGAACAAGAAAGCCAAACCCGTTCCCTGG
GTGGAAAAATATCGCCCAAAATGTGTGGATGAAGTTGCTTTCCAGGAAGAAGTGGTTGCA
GTGCTGAAAAAATCTTTAGAAGGAGCAGATCTTCCTAATCTCTTGTTTTACGGACCACCT
GGAACTGGAAAAACATCCACTATTTTGGCAGCAGCTAGAGAACTCTTTGGGCCTGAACTT
TTCCGATTAAGAGTTCTTGAGTTAAATGCATCTGATGAACGTGGAATACAAGTAGTTCGA
GAGAAAGTGAAAAATTTTGCTCAATTAACTGTGTCAGGAAGTCGCTCAGATGGGAAGCCG
TGTCCGCCTTTTAAGATTGTGATTCTGGATGAAGCAGATTCTATGACCTCAGCTGCTCAG
GCAGCTTTAAGACGTACCATGGAGAAGGAGTCGAAAACCACCCGATTCTGTCTTATCTGT
AACTATGTCAGTCGAATAATTGAACCCCTGACCTCTAGATGTTCAAAATTCAGCTTCAAG
CCTCTGTCAGATAAAATTCAACAGCAGCGATTACTAGACATTGCCAAGAAGGAAAATGTC
AAAATTAGTGATGAGGGAATAGCTTATCTTGTTAAAGTGTCAGAAGGAGACTTAAGAAAA
GCCATTACATTTCTTCAAAGCGCTACTCGATTAACAGGTGGAAAGGAGATCACAGAGAAA
GTGATTACAGACATTGCTGGGGTAATACCAGCTGAGAAAATTGATGGAGTATTTGCTGCC
TGTCAGAGTGGCTCTTTTGACAAACTAGAAGCTGTGGTCAAGGATTTAATAGATGAGGGT
CATGCAGCAACTCAGCTCGTCAATCAACTCCATGATGTGGTTGTAGAAAATAACTTATCT
GATAAACAGAAGTCTATTATCACAGAAAAACTTGCCGAAGTTGACAAATGCCTAGCAGAT
GGTGCTGATGAACATTTGCAACTCATCAGCCTTTGTGCAACTGTGATGCAGCAGTTATCT
CAGAATTGTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1375
Start on reference sequence 284
Mutations:
None
Discrepancy:
c592a,R198S
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RFC4
Symbol Nomenclature : RFC4
SYNONYM : A1; RFC37
Designation : A1 37 kDa subunit|RF-C 37 kDa subunit|RFC 37 kDa subunit|activator 1 37 kDa subunit|activator 1 subunit 4|replication factor C 37 kDa subunit|replication factor C subunit 4
Full Nomenclature : replication factor C (activator 1) 4, 37kDa
GENEID : 5984
GI : 61367092
GenBank Accession : AY891019
HGNC : 9972
MIM : 102577
Vega : OTTHUMG00000156515
Target GenBank: NM_002916

 

Reference Sequence Alignment

  

HsCD00000794      ATGCAAGCATTTCTTAAAGGTACATCCATCAGTACTAAACCCCCGCTGACCAAGGATCGA
NM_181573.2       ATGCAAGCATTTCTTAAAGGTACATCCATCAGTACTAAACCCCCGCTGACCAAGGATCGA
NM_002916.3       ATGCAAGCATTTCTTAAAGGTACATCCATCAGTACTAAACCCCCGCTGACCAAGGATCGA
                  ************************************************************

HsCD00000794      GGAGTAGCTGCCAGTGCGGGAAGTAGCGGAGAGAACAAGAAAGCCAAACCCGTTCCCTGG
NM_181573.2       GGAGTAGCTGCCAGTGCGGGAAGTAGCGGAGAGAACAAGAAAGCCAAACCCGTTCCCTGG
NM_002916.3       GGAGTAGCTGCCAGTGCGGGAAGTAGCGGAGAGAACAAGAAAGCCAAACCCGTTCCCTGG
                  ************************************************************

HsCD00000794      GTGGAAAAATATCGCCCAAAATGTGTGGATGAAGTTGCTTTCCAGGAAGAAGTGGTTGCA
NM_181573.2       GTGGAAAAATATCGCCCAAAATGTGTGGATGAAGTTGCTTTCCAGGAAGAAGTGGTTGCA
NM_002916.3       GTGGAAAAATATCGCCCAAAATGTGTGGATGAAGTTGCTTTCCAGGAAGAAGTGGTTGCA
                  ************************************************************

HsCD00000794      GTGCTGAAAAAATCTTTAGAAGGAGCAGATCTTCCTAATCTCTTGTTTTACGGACCACCT
NM_181573.2       GTGCTGAAAAAATCTTTAGAAGGAGCAGATCTTCCTAATCTCTTGTTTTACGGACCACCT
NM_002916.3       GTGCTGAAAAAATCTTTAGAAGGAGCAGATCTTCCTAATCTCTTGTTTTACGGACCACCT
                  ************************************************************

HsCD00000794      GGAACTGGAAAAACATCCACTATTTTGGCAGCAGCTAGAGAACTCTTTGGGCCTGAACTT
NM_181573.2       GGAACTGGAAAAACATCCACTATTTTGGCAGCAGCTAGAGAACTCTTTGGGCCTGAACTT
NM_002916.3       GGAACTGGAAAAACATCCACTATTTTGGCAGCAGCTAGAGAACTCTTTGGGCCTGAACTT
                  ************************************************************

HsCD00000794      TTCCGATTAAGAGTTCTTGAGTTAAATGCATCTGATGAACGTGGAATACAAGTAGTTCGA
NM_181573.2       TTCCGATTAAGAGTTCTTGAGTTAAATGCATCTGATGAACGTGGAATACAAGTAGTTCGA
NM_002916.3       TTCCGATTAAGAGTTCTTGAGTTAAATGCATCTGATGAACGTGGAATACAAGTAGTTCGA
                  ************************************************************

HsCD00000794      GAGAAAGTGAAAAATTTTGCTCAATTAACTGTGTCAGGAAGTCGCTCAGATGGGAAGCCG
NM_181573.2       GAGAAAGTGAAAAATTTTGCTCAATTAACTGTGTCAGGAAGTCGCTCAGATGGGAAGCCG
NM_002916.3       GAGAAAGTGAAAAATTTTGCTCAATTAACTGTGTCAGGAAGTCGCTCAGATGGGAAGCCG
                  ************************************************************

HsCD00000794      TGTCCGCCTTTTAAGATTGTGATTCTGGATGAAGCAGATTCTATGACCTCAGCTGCTCAG
NM_181573.2       TGTCCGCCTTTTAAGATTGTGATTCTGGATGAAGCAGATTCTATGACCTCAGCTGCTCAG
NM_002916.3       TGTCCGCCTTTTAAGATTGTGATTCTGGATGAAGCAGATTCTATGACCTCAGCTGCTCAG
                  ************************************************************

HsCD00000794      GCAGCTTTAAGACGTACCATGGAGAAGGAGTCGAAAACCACCCGATTCTGTCTTATCTGT
NM_181573.2       GCAGCTTTAAGACGTACCATGGAGAAGGAGTCGAAAACCACCCGATTCTGTCTTATCTGT
NM_002916.3       GCAGCTTTAAGACGTACCATGGAGAAGGAGTCGAAAACCACCCGATTCTGTCTTATCTGT
                  ************************************************************

HsCD00000794      AACTATGTCAGTCGAATAATTGAACCCCTGACCTCTAGATGTTCAAAATTCAGCTTCAAG
NM_181573.2       AACTATGTCAGTCGAATAATTGAACCCCTGACCTCTAGATGTTCAAAATTCCGCTTCAAG
NM_002916.3       AACTATGTCAGTCGAATAATTGAACCCCTGACCTCTAGATGTTCAAAATTCCGCTTCAAG
                  ***************************************************.********

HsCD00000794      CCTCTGTCAGATAAAATTCAACAGCAGCGATTACTAGACATTGCCAAGAAGGAAAATGTC
NM_181573.2       CCTCTGTCAGATAAAATTCAACAGCAGCGATTACTAGACATTGCCAAGAAGGAAAATGTC
NM_002916.3       CCTCTGTCAGATAAAATTCAACAGCAGCGATTACTAGACATTGCCAAGAAGGAAAATGTC
                  ************************************************************

HsCD00000794      AAAATTAGTGATGAGGGAATAGCTTATCTTGTTAAAGTGTCAGAAGGAGACTTAAGAAAA
NM_181573.2       AAAATTAGTGATGAGGGAATAGCTTATCTTGTTAAAGTGTCAGAAGGAGACTTAAGAAAA
NM_002916.3       AAAATTAGTGATGAGGGAATAGCTTATCTTGTTAAAGTGTCAGAAGGAGACTTAAGAAAA
                  ************************************************************

HsCD00000794      GCCATTACATTTCTTCAAAGCGCTACTCGATTAACAGGTGGAAAGGAGATCACAGAGAAA
NM_181573.2       GCCATTACATTTCTTCAAAGCGCTACTCGATTAACAGGTGGAAAGGAGATCACAGAGAAA
NM_002916.3       GCCATTACATTTCTTCAAAGCGCTACTCGATTAACAGGTGGAAAGGAGATCACAGAGAAA
                  ************************************************************

HsCD00000794      GTGATTACAGACATTGCTGGGGTAATACCAGCTGAGAAAATTGATGGAGTATTTGCTGCC
NM_181573.2       GTGATTACAGACATTGCCGGGGTAATACCAGCTGAGAAAATTGATGGAGTATTTGCTGCC
NM_002916.3       GTGATTACAGACATTGCCGGGGTAATACCAGCTGAGAAAATTGATGGAGTATTTGCTGCC
                  ***************** ******************************************

HsCD00000794      TGTCAGAGTGGCTCTTTTGACAAACTAGAAGCTGTGGTCAAGGATTTAATAGATGAGGGT
NM_181573.2       TGTCAGAGTGGCTCTTTTGACAAACTAGAAGCTGTGGTCAAGGATTTAATAGATGAGGGT
NM_002916.3       TGTCAGAGTGGCTCTTTTGACAAACTAGAAGCTGTGGTCAAGGATTTAATAGATGAGGGT
                  ************************************************************

HsCD00000794      CATGCAGCAACTCAGCTCGTCAATCAACTCCATGATGTGGTTGTAGAAAATAACTTATCT
NM_181573.2       CATGCAGCAACTCAGCTCGTCAATCAACTCCATGATGTGGTTGTAGAAAATAACTTATCT
NM_002916.3       CATGCAGCAACTCAGCTCGTCAATCAACTCCATGATGTGGTTGTAGAAAATAACTTATCT
                  ************************************************************

HsCD00000794      GATAAACAGAAGTCTATTATCACAGAAAAACTTGCCGAAGTTGACAAATGCCTAGCAGAT
NM_181573.2       GATAAACAGAAGTCTATTATCACAGAAAAACTTGCCGAAGTTGACAAATGCCTAGCAGAT
NM_002916.3       GATAAACAGAAGTCTATTATCACAGAAAAACTTGCCGAAGTTGACAAATGCCTAGCAGAT
                  ************************************************************

HsCD00000794      GGTGCTGATGAACATTTGCAACTCATCAGCCTTTGTGCAACTGTGATGCAGCAGTTATCT
NM_181573.2       GGTGCTGATGAACATTTGCAACTCATCAGCCTTTGTGCAACTGTGATGCAGCAGTTATCT
NM_002916.3       GGTGCTGATGAACATTTGCAACTCATCAGCCTTTGTGCAACTGTGATGCAGCAGTTATCT
                  ************************************************************

HsCD00000794      CAGAATTGTTTG
NM_181573.2       CAGAATTGTTAA
NM_002916.3       CAGAATTGTTAA
                  **********:.

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA strand elongation
Reactome : Extension of Telomeres
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : Lagging Strand Synthesis
Reactome : Leading Strand Synthesis
Reactome : Nucleotide Excision Repair
Reactome : Polymerase switching
Reactome : Polymerase switching on the C-strand of the telomere
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication

Clone

Cloning Information : 7191
HIP Master Clone ID : 6749
Original Clone ID : FLH007191.01L

Organism


TAX_ID : 9606
Species Specific ID: 5984

Genome

Chromosome : 3
Map Location : 3q27
Ensembl : ENSG00000163918

Reagents

Labome : RFC4-antibody