DNASU Plasmid Repository • 480.965.5697 | Email

CTNNB1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CTNNB1
Gene Name:  catenin (cadherin-associated protein), beta 1, 88kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH258229.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00079878

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2346nts         Open reading frame : 1 to 2346
Reference Sequence Alignment

ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
CTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2556
Start on reference sequence 211
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CTNNB1
Symbol Nomenclature : CTNNB1
SYNONYM : CTNNB; MRD19; armadillo
Designation : catenin beta-1
Full Nomenclature : catenin (cadherin-associated protein), beta 1, 88kDa
GENEID : 1499
Locus Tag : OK/SW-cl.35
HGNC : 2514
MIM : 116806
Vega : OTTHUMG00000131393
Target GenBank: BC058926

 

Reference Sequence Alignment

  

HsCD00079878        ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
NM_001098210.1      ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
NM_001904.3         ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
NM_001098209.1      ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
                    ************************************************************

HsCD00079878        GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
NM_001098210.1      GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
NM_001904.3         GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
NM_001098209.1      GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
                    ************************************************************

HsCD00079878        ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
NM_001098210.1      ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
NM_001904.3         ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
NM_001098209.1      ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
                    ************************************************************

HsCD00079878        CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
NM_001098210.1      CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
NM_001904.3         CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
NM_001098209.1      CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
                    ************************************************************

HsCD00079878        GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
NM_001098210.1      GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
NM_001904.3         GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
NM_001098209.1      GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
                    ************************************************************

HsCD00079878        GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
NM_001098210.1      GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
NM_001904.3         GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
NM_001098209.1      GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
                    ************************************************************

HsCD00079878        AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
NM_001098210.1      AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
NM_001904.3         AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
NM_001098209.1      AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
                    ************************************************************

HsCD00079878        AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
NM_001098210.1      AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
NM_001904.3         AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
NM_001098209.1      AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
                    ************************************************************

HsCD00079878        AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
NM_001098210.1      AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
NM_001904.3         AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
NM_001098209.1      AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
                    ************************************************************

HsCD00079878        AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
NM_001098210.1      AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
NM_001904.3         AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
NM_001098209.1      AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
                    ************************************************************

HsCD00079878        ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
NM_001098210.1      ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
NM_001904.3         ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
NM_001098209.1      ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
                    ************************************************************

HsCD00079878        CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
NM_001098210.1      CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
NM_001904.3         CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
NM_001098209.1      CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
                    ************************************************************

HsCD00079878        GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
NM_001098210.1      GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
NM_001904.3         GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
NM_001098209.1      GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
                    ************************************************************

HsCD00079878        AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
NM_001098210.1      AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
NM_001904.3         AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
NM_001098209.1      AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
                    ************************************************************

HsCD00079878        AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
NM_001098210.1      AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
NM_001904.3         AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
NM_001098209.1      AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
                    ************************************************************

HsCD00079878        CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
NM_001098210.1      CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
NM_001904.3         CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
NM_001098209.1      CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
                    ************************************************************

HsCD00079878        CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
NM_001098210.1      CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
NM_001904.3         CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
NM_001098209.1      CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
                    ************************************************************

HsCD00079878        AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
NM_001098210.1      AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
NM_001904.3         AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
NM_001098209.1      AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
                    ************************************************************

HsCD00079878        GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
NM_001098210.1      GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
NM_001904.3         GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
NM_001098209.1      GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
                    ************************************************************

HsCD00079878        TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
NM_001098210.1      TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
NM_001904.3         TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
NM_001098209.1      TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
                    ************************************************************

HsCD00079878        CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
NM_001098210.1      CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
NM_001904.3         CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
NM_001098209.1      CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
                    ************************************************************

HsCD00079878        GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
NM_001098210.1      GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
NM_001904.3         GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
NM_001098209.1      GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
                    ************************************************************

HsCD00079878        GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
NM_001098210.1      GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
NM_001904.3         GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
NM_001098209.1      GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
                    ************************************************************

HsCD00079878        ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
NM_001098210.1      ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
NM_001904.3         ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
NM_001098209.1      ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
                    ************************************************************

HsCD00079878        GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
NM_001098210.1      GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
NM_001904.3         GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
NM_001098209.1      GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
                    ************************************************************

HsCD00079878        CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
NM_001098210.1      CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
NM_001904.3         CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
NM_001098209.1      CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
                    ************************************************************

HsCD00079878        CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
NM_001098210.1      CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
NM_001904.3         CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
NM_001098209.1      CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
                    ************************************************************

HsCD00079878        GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
NM_001098210.1      GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
NM_001904.3         GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
NM_001098209.1      GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
                    ************************************************************

HsCD00079878        GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
NM_001098210.1      GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
NM_001904.3         GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
NM_001098209.1      GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
                    ************************************************************

HsCD00079878        GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
NM_001098210.1      GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
NM_001904.3         GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
NM_001098209.1      GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
                    ************************************************************

HsCD00079878        CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
NM_001098210.1      CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
NM_001904.3         CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
NM_001098209.1      CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
                    ************************************************************

HsCD00079878        CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
NM_001098210.1      CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
NM_001904.3         CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
NM_001098209.1      CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
                    ************************************************************

HsCD00079878        ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
NM_001098210.1      ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
NM_001904.3         ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
NM_001098209.1      ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
                    ************************************************************

HsCD00079878        CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
NM_001098210.1      CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
NM_001904.3         CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
NM_001098209.1      CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
                    ************************************************************

HsCD00079878        TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
NM_001098210.1      TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
NM_001904.3         TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
NM_001098209.1      TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
                    ************************************************************

HsCD00079878        GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
NM_001098210.1      GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
NM_001904.3         GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
NM_001098209.1      GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
                    ************************************************************

HsCD00079878        TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
NM_001098210.1      TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
NM_001904.3         TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
NM_001098209.1      TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
                    ************************************************************

HsCD00079878        GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
NM_001098210.1      GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
NM_001904.3         GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
NM_001098209.1      GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
                    ************************************************************

HsCD00079878        GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
NM_001098210.1      GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
NM_001904.3         GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
NM_001098209.1      GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
                    ************************************************************

HsCD00079878        CTGTTG
NM_001098210.1      CTGTAA
NM_001904.3         CTGTAA
NM_001098209.1      CTGTAA
                    ****:.

Pathways

NCI : AP-1 transcription factor network
NCI : Arf6 trafficking events
NCI : CDC42 signaling events
NCI : Canonical Wnt signaling pathway
NCI : Coregulation of Androgen receptor activity
NCI : Degradation of beta catenin
NCI : E-cadherin signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : FoxO family signaling
NCI : Integrin-linked kinase signaling
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Presenilin action in Notch and Wnt signaling
NCI : RAC1 signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Stabilization and expansion of the E-cadherin adherens junction
NCI : TGF-beta receptor signaling
Panther : Alzheimer disease-presenilin pathway
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Wnt signaling pathway
Panther : p53 pathway feedback loops 2
Reactome : Adherens junctions interactions
Reactome : Apoptosis
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Beta-catenin phosphorylation cascade
Reactome : CDO in myogenesis
Reactome : Ca2+ pathway
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Cell-cell junction organization
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : Developmental Biology
Reactome : Immune System
Reactome : Incretin synthesis, secretion, and inactivation
Reactome : Innate Immune System
Reactome : LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production
Reactome : Metabolism of proteins
Reactome : Myogenesis
Reactome : Peptide hormone metabolism
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Synthesis, secretion, and inactivation of Glucagon-like Peptide-1 (GLP-1)
Reactome : TCF dependent signaling in response to WNT
Reactome : beta-catenin independent WNT signaling
Reactome : binding of TCF/LEF:CTNNB1 to target gene promoters
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
Reactome : formation of the beta-catenin:TCF transactivating complex
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Heart Development
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Neural Crest Differentiation
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : ARM : Armadillo/beta-catenin-like repeats
UniProt : P35222
HPRD : 00286

Clone

Cloning Information : 258229
HIP Master Clone ID : 194845
Original Clone ID : FLH258229.01L

Organism


TAX_ID : 9606
Species Specific ID: 1499

Genome

Chromosome : 3
Map Location : 3p21
Ensembl : ENSG00000168036

Reagents

Labome : beta-catenin-antibody