DNASU Plasmid Repository • 480.965.5697 | Email

GLIS2 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GLIS2
Gene Name:  GLIS family zinc finger 2
Sequence             
Original Clone ID: FLH264753.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00080134

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1575nts         Open reading frame : 1 to 1575
Reference Sequence Alignment

ATGCACTCCCTGGACGAGCCGCTCGACCTGAAGCTGAGTATCACCAAGCTCCGGGCGGCA
AGAGAGAAGCGGGAGAGGACGCTGGGTGTGGTCCGGCCCCGTGCTCTGCACAGGGAGCTG
GGCCTGGTGGATGACAGCCCCACACCTGGCTCTCCAGGCTCCCCGCCCTCAGGCTTCCTG
CTGAACTCCAAGTTCCCCGAGAAGGTGGAGGGACGCTTTTCAGCAGCCCCTCTCGTGGAC
CTCAGCCTGTCACCACCATCTGGGCTGGACTCCCCCAATGGCAGCAGCTCGCTGTCCCCC
GAGCGCCAGGGCAACGGGGACCTGCCTCCAGTGCCCAGTGCCTCGGACTTCCAGCCACTG
CGCTATTTGGATGGTGTCCCCAGCTCCTTCCAGTTCTTCCTGCCCCTCGGCTCCGGGGGG
GCCCTGCACCTGCCTGCCTCCTCCTTCCTTACCCCTCCCAAGGACAAGTGCCTCTCGCCA
GACCTGCCCCTGCCCAAGCAGCTGGTGTGTCGCTGGGCCAAGTGTAACCAGCTCTTTGAG
CTCCTGCAAGACCTGGTGGACCATGTCAACGATTACCATGTCAAGCCCGAGAAGGATGCG
GGGTACTGCTGCCACTGGGAGGGCTGCGCCCGCCATGGCCGAGGTTTCAACGCCAGGTAC
AAGATGCTCATCCACATCCGCACACACACCAACGAGAAGCCACACCGCTGTCCGACCTGC
AGCAAGAGCTTCTCCCGCCTGGAGAACCTGAAGATCCACAACCGGTCGCACACAGGTGAG
AAGCCCTACGTCTGCCCCTACGAGGGCTGCAACAAGCGCTATTCCAACTCCAGTGACCGC
TTTAAGCACACGCGCACCCACTATGTGGACAAGCCCTACTACTGCAAGATGCCCGGCTGC
CACAAGCGCTACACGGACCCCAGCTCACTGCGCAAGCACATCAAGGCCCATGGCCACTTT
GTGTCCCACGAGCAGCAAGAGCTCCTGCAGCTGCGCCCACCCCCCAAGCCGCCACTGCCC
GCCCCCGACGGCGGCCCCTATGTCAGTGGGGCCCAGATCATCATCCCCAACCCAGCTGCC
CTCTTTGGAGGCCCTGGCCTGCCCGGCTTACCCCTACCCCTGGCCCCCGGCCCCCTTGAC
CTCAGTGCCCTGGCCTGTGGCAACGGTGGGGGCAGTGGGGGTGGGGGGGGCATGGGCCCT
GGGCTGCCAGGCCCCGTCCTGCCTCTCAATCTGGCCAAGAACCCGCTGCTGCCCTCGCCC
TTTGGGGCTGGCGGACTGGGCTTGCCTGTGGTCTCCCTCCTTGCTGGCGCAGCTGGTGGC
AAGGCCGAGGGGGAGAAGGGGCGTGGGTCGGTGCCCACCAGGGCCCTGGGCATGGAGGGC
CACAAGACGCCCCTTGAAAGGACGGAGAGCAGCTGCTCCCGGCCAAGCCCCGATGGACTC
CCCCTGCTGCCAGGCACCGTGCTGGACCTGTCCACGGGCGTCAACTCAGCTGCCAGCAGC
CCAGAGGCGTTGGCCCCTGGCTGGGTGGTCATCCCGCCGGGCTCGGTGCTGCTCAAACCG
GCTGTGGTGAACTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1632
Start on reference sequence 58
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GLIS2
Symbol Nomenclature : GLIS2
SYNONYM : NKL; NPHP7
Designation : GLI-similar 2|GLI-similar protein 2|Kruppel-like zinc finger protein GLIS2|nephrocystin-7|neuronal Krueppel-like protein|zinc finger protein GLIS2
Full Nomenclature : GLIS family zinc finger 2
GENEID : 84662
GI : 148922344
GenBank Accession : BC146548
HGNC : 29450
MIM : 608539
Vega : OTTHUMG00000129467
Target GenBank: NM_032575

 

Reference Sequence Alignment

  

HsCD00080134        ATGCACTCCCTGGACGAGCCGCTCGACCTGAAGCTGAGTATCACCAAGCTCCGGGCGGCA
NM_032575.2         ATGCACTCCCTGGACGAGCCGCTCGACCTGAAGCTGAGTATCACCAAGCTCCGGGCGGCA
XM_005255642.1      ATGCACTCCCTGGACGAGCCGCTCGACCTGAAGCTGAGTATCACCAAGCTCCGGGCGGCA
                    ************************************************************

HsCD00080134        AGAGAGAAGCGGGAGAGGACGCTGGGTGTGGTCCGGCCCCGTGCTCTGCACAGGGAGCTG
NM_032575.2         AGAGAGAAGCGGGAGAGGACGCTGGGTGTGGTCCGGCCCCGTGCTCTGCACAGGGAGCTG
XM_005255642.1      AGAGAGAAGCGGGAGAGGACGCTGGGTGTGGTCCGGCCCCGTGCTCTGCACAGGGAGCTG
                    ************************************************************

HsCD00080134        GGCCTGGTGGATGACAGCCCCACACCTGGCTCTCCAGGCTCCCCGCCCTCAGGCTTCCTG
NM_032575.2         GGCCTGGTGGATGACAGCCCCACACCTGGCTCTCCAGGCTCCCCGCCCTCAGGCTTCCTG
XM_005255642.1      GGCCTGGTGGATGACAGCCCCACACCTGGCTCTCCAGGCTCCCCGCCCTCAGGCTTCCTG
                    ************************************************************

HsCD00080134        CTGAACTCCAAGTTCCCCGAGAAGGTGGAGGGACGCTTTTCAGCAGCCCCTCTCGTGGAC
NM_032575.2         CTGAACTCCAAGTTCCCCGAGAAGGTGGAGGGACGCTTTTCAGCAGCCCCTCTCGTGGAC
XM_005255642.1      CTGAACTCCAAGTTCCCCGAGAAGGTGGAGGGACGCTTTTCAGCAGCCCCTCTCGTGGAC
                    ************************************************************

HsCD00080134        CTCAGCCTGTCACCACCATCTGGGCTGGACTCCCCCAATGGCAGCAGCTCGCTGTCCCCC
NM_032575.2         CTCAGCCTGTCACCACCATCTGGGCTGGACTCCCCCAATGGCAGCAGCTCGCTGTCCCCC
XM_005255642.1      CTCAGCCTGTCACCACCATCTGGGCTGGACTCCCCCAATGGCAGCAGCTCGCTGTCCCCC
                    ************************************************************

HsCD00080134        GAGCGCCAGGGCAACGGGGACCTGCCTCCAGTGCCCAGTGCCTCGGACTTCCAGCCACTG
NM_032575.2         GAGCGCCAGGGCAACGGGGACCTGCCTCCAGTGCCCAGTGCCTCGGACTTCCAGCCACTG
XM_005255642.1      GAGCGCCAGGGCAACGGGGACCTGCCTCCAGTGCCCAGTGCCTCGGACTTCCAGCCACTG
                    ************************************************************

HsCD00080134        CGCTATTTGGATGGTGTCCCCAGCTCCTTCCAGTTCTTCCTGCCCCTCGGCTCCGGGGGG
NM_032575.2         CGCTATTTGGATGGTGTCCCCAGCTCCTTCCAGTTCTTCCTGCCCCTCGGCTCCGGGGGG
XM_005255642.1      CGCTATTTGGATGGTGTCCCCAGCTCCTTCCAGTTCTTCCTGCCCCTCGGCTCCGGGGGG
                    ************************************************************

HsCD00080134        GCCCTGCACCTGCCTGCCTCCTCCTTCCTTACCCCTCCCAAGGACAAGTGCCTCTCGCCA
NM_032575.2         GCCCTGCACCTGCCTGCCTCCTCCTTCCTTACCCCTCCCAAGGACAAGTGCCTCTCGCCA
XM_005255642.1      GCCCTGCACCTGCCTGCCTCCTCCTTCCTTACCCCTCCCAAGGACAAGTGCCTCTCGCCA
                    ************************************************************

HsCD00080134        GACCTGCCCCTGCCCAAGCAGCTGGTGTGTCGCTGGGCCAAGTGTAACCAGCTCTTTGAG
NM_032575.2         GACCTGCCCCTGCCCAAGCAGCTGGTGTGTCGCTGGGCCAAGTGTAACCAGCTCTTTGAG
XM_005255642.1      GACCTGCCCCTGCCCAAGCAGCTGGTGTGTCGCTGGGCCAAGTGTAACCAGCTCTTTGAG
                    ************************************************************

HsCD00080134        CTCCTGCAAGACCTGGTGGACCATGTCAACGATTACCATGTCAAGCCCGAGAAGGATGCG
NM_032575.2         CTCCTGCAAGACCTGGTGGACCATGTCAACGATTACCATGTCAAGCCCGAGAAGGATGCG
XM_005255642.1      CTCCTGCAAGACCTGGTGGACCATGTCAACGATTACCATGTCAAGCCCGAGAAGGATGCG
                    ************************************************************

HsCD00080134        GGGTACTGCTGCCACTGGGAGGGCTGCGCCCGCCATGGCCGAGGTTTCAACGCCAGGTAC
NM_032575.2         GGGTACTGCTGCCACTGGGAGGGCTGCGCCCGCCATGGCCGAGGTTTCAACGCCAGGTAC
XM_005255642.1      GGGTACTGCTGCCACTGGGAGGGCTGCGCCCGCCATGGCCGAGGTTTCAACGCCAGGTAC
                    ************************************************************

HsCD00080134        AAGATGCTCATCCACATCCGCACACACACCAACGAGAAGCCACACCGCTGTCCGACCTGC
NM_032575.2         AAGATGCTCATCCACATCCGCACACACACCAACGAGAAGCCACACCGCTGTCCGACCTGC
XM_005255642.1      AAGATGCTCATCCACATCCGCACACACACCAACGAGAAGCCACACCGCTGTCCGACCTGC
                    ************************************************************

HsCD00080134        AGCAAGAGCTTCTCCCGCCTGGAGAACCTGAAGATCCACAACCGGTCGCACACAGGTGAG
NM_032575.2         AGCAAGAGCTTCTCCCGCCTGGAGAACCTGAAGATCCACAACCGGTCGCACACAGGTGAG
XM_005255642.1      AGCAAGAGCTTCTCCCGCCTGGAGAACCTGAAGATCCACAACCGGTCGCACACAGGTGAG
                    ************************************************************

HsCD00080134        AAGCCCTACGTCTGCCCCTACGAGGGCTGCAACAAGCGCTATTCCAACTCCAGTGACCGC
NM_032575.2         AAGCCCTACGTCTGCCCCTACGAGGGCTGCAACAAGCGCTATTCCAACTCCAGTGACCGC
XM_005255642.1      AAGCCCTACGTCTGCCCCTACGAGGGCTGCAACAAGCGCTATTCCAACTCCAGTGACCGC
                    ************************************************************

HsCD00080134        TTTAAGCACACGCGCACCCACTATGTGGACAAGCCCTACTACTGCAAGATGCCCGGCTGC
NM_032575.2         TTTAAGCACACGCGCACCCACTATGTGGACAAGCCCTACTACTGCAAGATGCCCGGCTGC
XM_005255642.1      TTTAAGCACACGCGCACCCACTATGTGGACAAGCCCTACTACTGCAAGATGCCCGGCTGC
                    ************************************************************

HsCD00080134        CACAAGCGCTACACGGACCCCAGCTCACTGCGCAAGCACATCAAGGCCCATGGCCACTTT
NM_032575.2         CACAAGCGCTACACGGACCCCAGCTCACTGCGCAAGCACATCAAGGCCCATGGCCACTTT
XM_005255642.1      CACAAGCGCTACACGGACCCCAGCTCACTGCGCAAGCACATCAAGGCCCATGGCCACTTT
                    ************************************************************

HsCD00080134        GTGTCCCACGAGCAGCAAGAGCTCCTGCAGCTGCGCCCACCCCCCAAGCCGCCACTGCCC
NM_032575.2         GTGTCCCACGAGCAGCAAGAGCTCCTGCAGCTGCGCCCACCCCCCAAGCCGCCACTGCCC
XM_005255642.1      GTGTCCCACGAGCAGCAAGAGCTCCTGCAGCTGCGCCCACCCCCCAAGCCGCCACTGCCC
                    ************************************************************

HsCD00080134        GCCCCCGACGGCGGCCCCTATGTCAGTGGGGCCCAGATCATCATCCCCAACCCAGCTGCC
NM_032575.2         GCCCCCGACGGCGGCCCCTATGTCAGTGGGGCCCAGATCATCATCCCCAACCCAGCTGCC
XM_005255642.1      GCCCCCGACGGCGGCCCCTATGTCAGTGGGGCCCAGATCATCATCCCCAACCCAGCTGCC
                    ************************************************************

HsCD00080134        CTCTTTGGAGGCCCTGGCCTGCCCGGCTTACCCCTACCCCTGGCCCCCGGCCCCCTTGAC
NM_032575.2         CTCTTTGGAGGCCCTGGCCTGCCCGGCTTACCCCTACCCCTGGCCCCCGGCCCCCTTGAC
XM_005255642.1      CTCTTTGGAGGCCCTGGCCTGCCCGGCTTACCCCTACCCCTGGCCCCCGGCCCCCTTGAC
                    ************************************************************

HsCD00080134        CTCAGTGCCCTGGCCTGTGGCAACGGTGGGGGCAGTGGGGGTGGGGGGGGCATGGGCCCT
NM_032575.2         CTCAGTGCCCTGGCCTGTGGCAACGGTGGGGGCAGTGGGGGTGGGGGGGGCATGGGCCCT
XM_005255642.1      CTCAGTGCCCTGGCCTGTGGCAACGGTGGGGGCAGTGGGGGTGGGGGGGGCATGGGCCCT
                    ************************************************************

HsCD00080134        GGGCTGCCAGGCCCCGTCCTGCCTCTCAATCTGGCCAAGAACCCGCTGCTGCCCTCGCCC
NM_032575.2         GGGCTGCCAGGCCCCGTCCTGCCTCTCAATCTGGCCAAGAACCCGCTGCTGCCCTCGCCC
XM_005255642.1      GGGCTGCCAGGCCCCGTCCTGCCTCTCAATCTGGCCAAGAACCCGCTGCTGCCCTCGCCC
                    ************************************************************

HsCD00080134        TTTGGGGCTGGCGGACTGGGCTTGCCTGTGGTCTCCCTCCTTGCTGGCGCAGCTGGTGGC
NM_032575.2         TTTGGGGCTGGCGGACTGGGCTTGCCTGTGGTCTCCCTCCTTGCTGGCGCAGCTGGTGGC
XM_005255642.1      TTTGGGGCTGGCGGACTGGGCTTGCCTGTGGTCTCCCTCCTTGCTGGCGCAGCTGGTGGC
                    ************************************************************

HsCD00080134        AAGGCCGAGGGGGAGAAGGGGCGTGGGTCGGTGCCCACCAGGGCCCTGGGCATGGAGGGC
NM_032575.2         AAGGCCGAGGGGGAGAAGGGGCGTGGGTCGGTGCCCACCAGGGCCCTGGGCATGGAGGGC
XM_005255642.1      AAGGCCGAGGGGGAGAAGGGGCGTGGGTCGGTGCCCACCAGGGCCCTGGGCATGGAGGGC
                    ************************************************************

HsCD00080134        CACAAGACGCCCCTTGAAAGGACGGAGAGCAGCTGCTCCCGGCCAAGCCCCGATGGACTC
NM_032575.2         CACAAGACGCCCCTTGAAAGGACGGAGAGCAGCTGCTCCCGGCCAAGCCCCGATGGACTC
XM_005255642.1      CACAAGACGCCCCTTGAAAGGACGGAGAGCAGCTGCTCCCGGCCAAGCCCCGATGGACTC
                    ************************************************************

HsCD00080134        CCCCTGCTGCCAGGCACCGTGCTGGACCTGTCCACGGGCGTCAACTCAGCTGCCAGCAGC
NM_032575.2         CCCCTGCTGCCAGGCACCGTGCTGGACCTGTCCACGGGCGTCAACTCAGCTGCCAGCAGC
XM_005255642.1      CCCCTGCTGCCAGGCACCGTGCTGGACCTGTCCACGGGCGTCAACTCAGCTGCCAGCAGC
                    ************************************************************

HsCD00080134        CCAGAGGCGTTGGCCCCTGGCTGGGTGGTCATCCCGCCGGGCTCGGTGCTGCTCAAACCG
NM_032575.2         CCAGAGGCGTTGGCCCCTGGCTGGGTGGTCATCCCGCCGGGCTCGGTGCTGCTCAAACCG
XM_005255642.1      CCAGAGGCGTTGGCCCCTGGCTGGGTGGTCATCCCGCCGGGCTCGGTGCTGCTCAAACCG
                    ************************************************************

HsCD00080134        GCTGTGGTGAACTAA
NM_032575.2         GCTGTGGTGAACTGA
XM_005255642.1      GCTGTGGTGAACTGA
                    *************.*

Protein

SMART domain : ZnF_C2H2 : zinc finger
UniProt : Q9BZE0
HPRD : 12256

Clone

Cloning Information : 264753
HIP Master Clone ID : 196851
IMAGE ID : 100014972
Original Clone ID : FLH264753.01X

Organism


TAX_ID : 9606
Species Specific ID: 84662

Genome

Chromosome : 16
Map Location : 16p13.3
Ensembl : ENSG00000126603

Reagents

Labome : GLIS2-antibody