DNASU Plasmid Repository • 480.965.5697 | Email

DSG1 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DSG1
Gene Name:  desmoglein 1
Sequence             
Original Clone ID: FLH264814.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00080195

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3147nts         Open reading frame : 1 to 3147
Reference Sequence Alignment

ATGGACTGGAGTTTCTTCAGAGTAGTTGCAATGCTGTTCATTTTTCTGGTGGTGGTAGAA
GTTAACAGTGAATTCCGAATCCAGGTAAGAGATTATAACACTAAAAATGGCACCATCAAA
TGGCATTCAATCCGAAGGCAGAAACGTGAATGGATCAAGTTCGCAGCAGCCTGTCGTGAA
GGTGAAGACAACTCAAAGAGGAACCCAATCGCCAAAATTCACTCAGATTGTGCTGCAAAC
CAGCAAGTTACATACCGCATCTCTGGAGTAGGAATTGATCAGCCACCATATGGGATCTTT
GTCATTAATCAGAAAACTGGTGAAATTAATATAACATCCATAGTTGATCGAGAGGTCACT
CCTTTCTTCATTATCTACTGCCGAGCTCTGAACTCAATGGGCCAAGATTTAGAGAGGCCT
CTAGAGCTCAGAGTCAGGGTTTTGGATATAAATGACAACCCTCCAGTGTTTTCAATGGCT
ACATTTGCAGGACAAATAGAAGAAAATTCTAATGCAAATACACTGGTGATGATACTCAAT
GCTACTGACGCAGATGAACCGAACAATTTGAACTCAAAAATAGCCTTCAAGATTATAAGA
CAAGAACCTTCAGATTCACCAATGTTTATTATCAACAGAAATACTGGAGAAATTCGAACG
ATGAATAATTTTCTAGACAGAGAGCAATACGGCCAGTATGCTCTTGCTGTAAGAGGCTCT
GACCGAGATGGTGGGGCAGATGGCATGTCAGCGGAATGTGAGTGCAACATTAAAATCCTC
GATGTCAATGATAATATCCCTTACATGGAACAGTCTTCATATACCATAGAAATTCAAGAA
AATACTCTAAATTCAAATTTGCTCGAGATTAGAGTAATTGATTTGGATGAAGAGTTCTCA
GCTAACTGGATGGCAGTAATTTTCTTTATCTCTGGAAATGAAGGAAATTGGTTTGAGATA
GAAATGAATGAAAGAACAAATGTGGGAATTTTAAAGGTTGTTAAGCCCTTAGATTATGAA
GCTATGCAGAGTCTGCAACTCAGTATTGGTGTCAGAAATAAAGCTGAATTTCATCATTCA
ATTATGTCTCAATATAAACTGAAAGCATCTGCAATTTCTGTGACTGTGTTAAATGTAATT
GAAGGCCCAGTGTTTCGTCCAGGTTCAAAGACATATGTTGTAACTGGTAATATGGGATCA
AATGATAAAGTGGGAGACTTTGTAGCTACTGACCTGGACACAGGTAGACCTTCAACGACT
GTTAGGTATGTAATGGGAAATAATCCAGCTGACCTGCTAGCTGTTGATTCAAGAACAGGC
AAACTCACTTTGAAAAATAAAGTTACCAAGGAACAGTACAATATGCTCGGAGGAAAATAC
CAAGGAACGATTCTCTCTATAGATGATAATCTTCAAAGAACTTGCACTGGTACAATTAAT
ATTAACATTCAAAGTTTTGGTAATGACGACAGGACTAATACAGAGCCGAACACTAAAATT
ACTACCAATACTGGCAGACAAGAAAGTACTTCTTCCACTAACTATGATACCAGCACAACT
TCTACTGACTCTAGCCAAGTATATTCTTCTGAACCCGGAAACGGAGCCAAAGATTTGTTA
TCAGACAATGTACATTTTGGTCCTGCTGGCATTGGACTCCTCATCATGGGATTCTTGGTC
TTAGGATTGGTCCCATTTTTGATGATCTGTTGTGATTGTGGAGGTGCTCCTCGTAGTGCA
GCTGGCTTTGAGCCTGTTCCCGAATGTTCAGATGGAGCAATTCATTCATGGGCAGTAGAA
GGACCACAGCCTGAACCCAGGGATATAACCACTGTCATACCACAAATACCACCTGATAAC
GCAAATATAATTGAATGCATTGACAACTCAGGAGTTTATACAAATGAGTATGGTGGCAGA
GAAATGCAAGATCTGGGAGGAGGAGAGAGAATGACAGGATTTGAACTAACAGAGGGAGTT
AAAACTTCAGGAATGCCTGAGATATGTCAAGAATACTCTGGAACATTAAGAAGAAATTCT
ATGAGGGAATGTAGAGAAGGAGGTCTGAATATGAATTTCATGGAAAGCTACTTCTGTCAG
AAAGCATATGCTTACGCAGATGAAGATGAAGGACGCCCATCTAATGACTGTTTGCTCATA
TATGACATCGAAGGTGTAGGTTCCCCTGCTGGCTCTGTGGGTTGTTGTAGCTTCATTGGA
GAAGACCTGGATGACAGCTTCTTGGATACCCTGGGACCTAAATTTAAGAAGTTGGCAGAC
ATCAGCCTAGGAAAAGAATCATATCCAGACCTTGATCCTTCTTGGCCACCACAAAGCACT
GAACCAGTTTGCCTTCCTCAGGAAACAGAGCCCGTTGTTAGTGGACACCCACCAATCTCC
CCACATTTCGGCACTACCACAGTAATTTCTGAGAGCACCTATCCCTCGGGACCTGGTGTA
CTGCATCCTAAGCCTATTCTCGATCCTCTGGGCTATGGTAATGTCACTGTGACCGAGTCT
TACACCACCTCTGACACTCTGAAGCCCTCTGTGCACGTTCACGATAACCGACCAGCATCA
AACGTGGTAGTGACAGAGAGAGTGGTCGGCCCAATCTCTGGCGCTGATTTGCATGGAATG
TTAGAGATGCCTGACTTGCGAGATGGGTCGAATGTTATAGTGACAGAAAGGGTAATAGCA
CCAAGCTCTAGTCTACCCACCTCTCTGACTATCCATCATCCTAGAGAGTCTTCAAATGTG
GTAGTGACAGAAAGAGTAATCCAACCAACTTCCGGCATGATAGGTAGTCTGAGTATGCAC
CCCGAGTTAGCCAATGCCCACAATGTCATTGTGACAGAGAGGGTTGTTTCTGGTGCTGGC
GTAACTGGAATTAGTGGCACCACTGGGATCAGCGGTGGCATAGGCAGCAGTGGCCTGGTT
GGCACCAGCATGGGTGCTGGGAGCGGTGCCCTGAGTGGAGCTGGCATAAGTGGTGGTGGC
ATTGGCCTGAGCAGCTTGGGAGGGACAGCCAGCATTGGCCACATGAGGAGTTCCTCTGAC
CATCACTTTAACCAAACCATTGGGTCCGCCTCCCCTAGCACAGCTCGAAGTCGAATCACA
AAGTATAGTACCGTGCAATATAGCAAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3362
Start on reference sequence 213
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DSG1
Symbol Nomenclature : DSG1
SYNONYM : CDHF4; DG1; DSG; EPKHE; EPKHIA; PPKS1; SPPK1
Designation : DGI|cadherin family member 4|desmoglein-1|desmosomal glycoprotein 1|pemphigus foliaceus antigen
Full Nomenclature : desmoglein 1
GENEID : 1828
GI : 151554984
GenBank Accession : BC148374
HGNC : 3048
MIM : 125670
Vega : OTTHUMG00000131983
Target GenBank: NM_001942

 

Reference Sequence Alignment

  

HsCD00080195      ATGGACTGGAGTTTCTTCAGAGTAGTTGCAATGCTGTTCATTTTTCTGGTGGTGGTAGAA
NM_001942.2       ATGGACTGGAGTTTCTTCAGAGTAGTTGCAATGCTGTTCATTTTTCTGGTGGTGGTAGAA
                  ************************************************************

HsCD00080195      GTTAACAGTGAATTCCGAATCCAGGTAAGAGATTATAACACTAAAAATGGCACCATCAAA
NM_001942.2       GTTAACAGTGAATTCCGAATCCAGGTAAGAGATTATAACACTAAAAATGGCACCATCAAA
                  ************************************************************

HsCD00080195      TGGCATTCAATCCGAAGGCAGAAACGTGAATGGATCAAGTTCGCAGCAGCCTGTCGTGAA
NM_001942.2       TGGCATTCAATCCGAAGGCAGAAACGTGAATGGATCAAGTTCGCAGCAGCCTGTCGTGAA
                  ************************************************************

HsCD00080195      GGTGAAGACAACTCAAAGAGGAACCCAATCGCCAAAATTCACTCAGATTGTGCTGCAAAC
NM_001942.2       GGTGAAGACAACTCAAAGAGGAACCCAATCGCCAAAATTCACTCAGATTGTGCTGCAAAC
                  ************************************************************

HsCD00080195      CAGCAAGTTACATACCGCATCTCTGGAGTAGGAATTGATCAGCCACCATATGGGATCTTT
NM_001942.2       CAGCAAGTTACATACCGCATCTCTGGAGTAGGAATTGATCAGCCACCATATGGGATCTTT
                  ************************************************************

HsCD00080195      GTCATTAATCAGAAAACTGGTGAAATTAATATAACATCCATAGTTGATCGAGAGGTCACT
NM_001942.2       GTCATTAATCAGAAAACTGGTGAAATTAATATAACATCCATAGTTGATCGAGAGGTCACT
                  ************************************************************

HsCD00080195      CCTTTCTTCATTATCTACTGCCGAGCTCTGAACTCAATGGGCCAAGATTTAGAGAGGCCT
NM_001942.2       CCTTTCTTCATTATCTACTGCCGAGCTCTGAACTCAATGGGCCAAGATTTAGAGAGGCCT
                  ************************************************************

HsCD00080195      CTAGAGCTCAGAGTCAGGGTTTTGGATATAAATGACAACCCTCCAGTGTTTTCAATGGCT
NM_001942.2       CTAGAGCTCAGAGTCAGGGTTTTGGATATAAATGACAACCCTCCAGTGTTTTCAATGGCT
                  ************************************************************

HsCD00080195      ACATTTGCAGGACAAATAGAAGAAAATTCTAATGCAAATACACTGGTGATGATACTCAAT
NM_001942.2       ACATTTGCAGGACAAATAGAAGAAAATTCTAATGCAAATACACTGGTGATGATACTCAAT
                  ************************************************************

HsCD00080195      GCTACTGACGCAGATGAACCGAACAATTTGAACTCAAAAATAGCCTTCAAGATTATAAGA
NM_001942.2       GCTACTGACGCAGATGAACCGAACAATTTGAACTCAAAAATAGCCTTCAAGATTATAAGA
                  ************************************************************

HsCD00080195      CAAGAACCTTCAGATTCACCAATGTTTATTATCAACAGAAATACTGGAGAAATTCGAACG
NM_001942.2       CAAGAACCTTCAGATTCACCAATGTTTATTATCAACAGAAATACTGGAGAAATTCGAACG
                  ************************************************************

HsCD00080195      ATGAATAATTTTCTAGACAGAGAGCAATACGGCCAGTATGCTCTTGCTGTAAGAGGCTCT
NM_001942.2       ATGAATAATTTTCTAGACAGAGAGCAATACGGCCAGTATGCTCTTGCTGTAAGAGGCTCT
                  ************************************************************

HsCD00080195      GACCGAGATGGTGGGGCAGATGGCATGTCAGCGGAATGTGAGTGCAACATTAAAATCCTC
NM_001942.2       GACCGAGATGGTGGGGCAGATGGCATGTCAGCGGAATGTGAGTGCAACATTAAAATCCTC
                  ************************************************************

HsCD00080195      GATGTCAATGATAATATCCCTTACATGGAACAGTCTTCATATACCATAGAAATTCAAGAA
NM_001942.2       GATGTCAATGATAATATCCCTTACATGGAACAGTCTTCATATACCATAGAAATTCAAGAA
                  ************************************************************

HsCD00080195      AATACTCTAAATTCAAATTTGCTCGAGATTAGAGTAATTGATTTGGATGAAGAGTTCTCA
NM_001942.2       AATACTCTAAATTCAAATTTGCTCGAGATTAGAGTAATTGATTTGGATGAAGAGTTCTCA
                  ************************************************************

HsCD00080195      GCTAACTGGATGGCAGTAATTTTCTTTATCTCTGGAAATGAAGGAAATTGGTTTGAGATA
NM_001942.2       GCTAACTGGATGGCAGTAATTTTCTTTATCTCTGGAAATGAAGGAAATTGGTTTGAGATA
                  ************************************************************

HsCD00080195      GAAATGAATGAAAGAACAAATGTGGGAATTTTAAAGGTTGTTAAGCCCTTAGATTATGAA
NM_001942.2       GAAATGAATGAAAGAACAAATGTGGGAATTTTAAAGGTTGTTAAGCCCTTAGATTATGAA
                  ************************************************************

HsCD00080195      GCTATGCAGAGTCTGCAACTCAGTATTGGTGTCAGAAATAAAGCTGAATTTCATCATTCA
NM_001942.2       GCTATGCAGAGTCTGCAACTCAGTATTGGTGTCAGAAATAAAGCTGAATTTCATCATTCA
                  ************************************************************

HsCD00080195      ATTATGTCTCAATATAAACTGAAAGCATCTGCAATTTCTGTGACTGTGTTAAATGTAATT
NM_001942.2       ATTATGTCTCAATATAAACTGAAAGCATCTGCAATTTCTGTGACTGTGTTAAATGTAATT
                  ************************************************************

HsCD00080195      GAAGGCCCAGTGTTTCGTCCAGGTTCAAAGACATATGTTGTAACTGGTAATATGGGATCA
NM_001942.2       GAAGGCCCAGTGTTTCGTCCAGGTTCAAAGACATATGTTGTAACTGGTAATATGGGATCA
                  ************************************************************

HsCD00080195      AATGATAAAGTGGGAGACTTTGTAGCTACTGACCTGGACACAGGTAGACCTTCAACGACT
NM_001942.2       AATGATAAAGTGGGAGACTTTGTAGCTACTGACCTGGACACAGGTAGACCTTCAACGACT
                  ************************************************************

HsCD00080195      GTTAGGTATGTAATGGGAAATAATCCAGCTGACCTGCTAGCTGTTGATTCAAGAACAGGC
NM_001942.2       GTTAGGTATGTAATGGGAAATAATCCAGCTGACCTGCTAGCTGTTGATTCAAGAACAGGC
                  ************************************************************

HsCD00080195      AAACTCACTTTGAAAAATAAAGTTACCAAGGAACAGTACAATATGCTCGGAGGAAAATAC
NM_001942.2       AAACTCACTTTGAAAAATAAAGTTACCAAGGAACAGTACAATATGCTCGGAGGAAAATAC
                  ************************************************************

HsCD00080195      CAAGGAACGATTCTCTCTATAGATGATAATCTTCAAAGAACTTGCACTGGTACAATTAAT
NM_001942.2       CAAGGAACGATTCTCTCTATAGATGATAATCTTCAAAGAACTTGCACTGGTACAATTAAT
                  ************************************************************

HsCD00080195      ATTAACATTCAAAGTTTTGGTAATGACGACAGGACTAATACAGAGCCGAACACTAAAATT
NM_001942.2       ATTAACATTCAAAGTTTTGGTAATGACGACAGGACTAATACAGAGCCGAACACTAAAATT
                  ************************************************************

HsCD00080195      ACTACCAATACTGGCAGACAAGAAAGTACTTCTTCCACTAACTATGATACCAGCACAACT
NM_001942.2       ACTACCAATACTGGCAGACAAGAAAGTACTTCTTCCACTAACTATGATACCAGCACAACT
                  ************************************************************

HsCD00080195      TCTACTGACTCTAGCCAAGTATATTCTTCTGAACCCGGAAACGGAGCCAAAGATTTGTTA
NM_001942.2       TCTACTGACTCTAGCCAAGTATATTCTTCTGAACCCGGAAACGGAGCCAAAGATTTGTTA
                  ************************************************************

HsCD00080195      TCAGACAATGTACATTTTGGTCCTGCTGGCATTGGACTCCTCATCATGGGATTCTTGGTC
NM_001942.2       TCAGACAATGTACATTTTGGTCCTGCTGGCATTGGACTCCTCATCATGGGATTCTTGGTC
                  ************************************************************

HsCD00080195      TTAGGATTGGTCCCATTTTTGATGATCTGTTGTGATTGTGGAGGTGCTCCTCGTAGTGCA
NM_001942.2       TTAGGATTGGTCCCATTTTTGATGATCTGTTGTGATTGTGGAGGTGCTCCTCGTAGTGCA
                  ************************************************************

HsCD00080195      GCTGGCTTTGAGCCTGTTCCCGAATGTTCAGATGGAGCAATTCATTCATGGGCAGTAGAA
NM_001942.2       GCTGGCTTTGAGCCTGTTCCCGAATGTTCAGATGGAGCAATTCATTCATGGGCAGTAGAA
                  ************************************************************

HsCD00080195      GGACCACAGCCTGAACCCAGGGATATAACCACTGTCATACCACAAATACCACCTGATAAC
NM_001942.2       GGACCACAGCCTGAACCCAGGGATATAACCACTGTCATACCACAAATACCACCTGATAAC
                  ************************************************************

HsCD00080195      GCAAATATAATTGAATGCATTGACAACTCAGGAGTTTATACAAATGAGTATGGTGGCAGA
NM_001942.2       GCAAATATAATTGAATGCATTGACAACTCAGGAGTTTATACAAATGAGTATGGTGGCAGA
                  ************************************************************

HsCD00080195      GAAATGCAAGATCTGGGAGGAGGAGAGAGAATGACAGGATTTGAACTAACAGAGGGAGTT
NM_001942.2       GAAATGCAAGATCTGGGAGGAGGAGAGAGAATGACAGGATTTGAACTAACAGAGGGAGTT
                  ************************************************************

HsCD00080195      AAAACTTCAGGAATGCCTGAGATATGTCAAGAATACTCTGGAACATTAAGAAGAAATTCT
NM_001942.2       AAAACTTCAGGAATGCCTGAGATATGTCAAGAATACTCTGGAACATTAAGAAGAAATTCT
                  ************************************************************

HsCD00080195      ATGAGGGAATGTAGAGAAGGAGGTCTGAATATGAATTTCATGGAAAGCTACTTCTGTCAG
NM_001942.2       ATGAGGGAATGTAGAGAAGGAGGTCTGAATATGAATTTCATGGAAAGCTACTTCTGTCAG
                  ************************************************************

HsCD00080195      AAAGCATATGCTTACGCAGATGAAGATGAAGGACGCCCATCTAATGACTGTTTGCTCATA
NM_001942.2       AAAGCATATGCTTACGCAGATGAAGATGAAGGACGCCCATCTAATGACTGTTTGCTCATA
                  ************************************************************

HsCD00080195      TATGACATCGAAGGTGTAGGTTCCCCTGCTGGCTCTGTGGGTTGTTGTAGCTTCATTGGA
NM_001942.2       TATGACATCGAAGGTGTAGGTTCCCCTGCTGGCTCTGTGGGTTGTTGTAGCTTCATTGGA
                  ************************************************************

HsCD00080195      GAAGACCTGGATGACAGCTTCTTGGATACCCTGGGACCTAAATTTAAGAAGTTGGCAGAC
NM_001942.2       GAAGACCTGGATGACAGCTTCTTGGATACCCTGGGACCTAAATTTAAGAAGTTGGCAGAC
                  ************************************************************

HsCD00080195      ATCAGCCTAGGAAAAGAATCATATCCAGACCTTGATCCTTCTTGGCCACCACAAAGCACT
NM_001942.2       ATCAGCCTAGGAAAAGAATCATATCCAGACCTTGATCCTTCTTGGCCACCACAAAGCACT
                  ************************************************************

HsCD00080195      GAACCAGTTTGCCTTCCTCAGGAAACAGAGCCCGTTGTTAGTGGACACCCACCAATCTCC
NM_001942.2       GAACCAGTTTGCCTTCCTCAGGAAACAGAGCCCGTTGTTAGTGGACACCCACCAATCTCC
                  ************************************************************

HsCD00080195      CCACATTTCGGCACTACCACAGTAATTTCTGAGAGCACCTATCCCTCGGGACCTGGTGTA
NM_001942.2       CCACATTTCGGCACTACCACAGTAATTTCTGAGAGCACCTATCCCTCGGGACCTGGTGTA
                  ************************************************************

HsCD00080195      CTGCATCCTAAGCCTATTCTCGATCCTCTGGGCTATGGTAATGTCACTGTGACCGAGTCT
NM_001942.2       CTGCATCCTAAGCCTATTCTCGATCCTCTGGGCTATGGTAATGTCACTGTGACCGAGTCT
                  ************************************************************

HsCD00080195      TACACCACCTCTGACACTCTGAAGCCCTCTGTGCACGTTCACGATAACCGACCAGCATCA
NM_001942.2       TACACCACCTCTGACACTCTGAAGCCCTCTGTGCACGTTCACGATAACCGACCAGCATCA
                  ************************************************************

HsCD00080195      AACGTGGTAGTGACAGAGAGAGTGGTCGGCCCAATCTCTGGCGCTGATTTGCATGGAATG
NM_001942.2       AACGTGGTAGTGACAGAGAGAGTGGTCGGCCCAATCTCTGGCGCTGATTTGCATGGAATG
                  ************************************************************

HsCD00080195      TTAGAGATGCCTGACTTGCGAGATGGGTCGAATGTTATAGTGACAGAAAGGGTAATAGCA
NM_001942.2       TTAGAGATGCCTGACTTGCGAGATGGGTCGAATGTTATAGTGACAGAAAGGGTAATAGCA
                  ************************************************************

HsCD00080195      CCAAGCTCTAGTCTACCCACCTCTCTGACTATCCATCATCCTAGAGAGTCTTCAAATGTG
NM_001942.2       CCAAGCTCTAGTCTACCCACCTCTCTGACTATCCATCATCCTAGAGAGTCTTCAAATGTG
                  ************************************************************

HsCD00080195      GTAGTGACAGAAAGAGTAATCCAACCAACTTCCGGCATGATAGGTAGTCTGAGTATGCAC
NM_001942.2       GTAGTGACAGAAAGAGTAATCCAACCAACTTCCGGCATGATAGGTAGTCTGAGTATGCAC
                  ************************************************************

HsCD00080195      CCCGAGTTAGCCAATGCCCACAATGTCATTGTGACAGAGAGGGTTGTTTCTGGTGCTGGC
NM_001942.2       CCCGAGTTAGCCAATGCCCACAATGTCATTGTGACAGAGAGGGTTGTTTCTGGTGCTGGC
                  ************************************************************

HsCD00080195      GTAACTGGAATTAGTGGCACCACTGGGATCAGCGGTGGCATAGGCAGCAGTGGCCTGGTT
NM_001942.2       GTAACTGGAATTAGTGGCACCACTGGGATCAGCGGTGGCATAGGCAGCAGTGGCCTGGTT
                  ************************************************************

HsCD00080195      GGCACCAGCATGGGTGCTGGGAGCGGTGCCCTGAGTGGAGCTGGCATAAGTGGTGGTGGC
NM_001942.2       GGCACCAGCATGGGTGCTGGGAGCGGTGCCCTGAGTGGAGCTGGCATAAGTGGTGGTGGC
                  ************************************************************

HsCD00080195      ATTGGCCTGAGCAGCTTGGGAGGGACAGCCAGCATTGGCCACATGAGGAGTTCCTCTGAC
NM_001942.2       ATTGGCCTGAGCAGCTTGGGAGGGACAGCCAGCATTGGCCACATGAGGAGTTCCTCTGAC
                  ************************************************************

HsCD00080195      CATCACTTTAACCAAACCATTGGGTCCGCCTCCCCTAGCACAGCTCGAAGTCGAATCACA
NM_001942.2       CATCACTTTAACCAAACCATTGGGTCCGCCTCCCCTAGCACAGCTCGAAGTCGAATCACA
                  ************************************************************

HsCD00080195      AAGTATAGTACCGTGCAATATAGCAAG---
NM_001942.2       AAGTATAGTACCGTGCAATATAGCAAGTAG
                  ***************************   

Pathways

Reactome : Apoptosis
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase

Protein

SMART domain : CA : Cadherin repeats.
UniProt : Q02413
HPRD : 00515

Clone

Cloning Information : 264814
HIP Master Clone ID : 196912
IMAGE ID : 100015331
Original Clone ID : FLH264814.01L

Organism


TAX_ID : 9606
Species Specific ID: 1828

Genome

Chromosome : 18
Map Location : 18q12.1
Ensembl : ENSG00000134760

Reagents

Labome : Dsg1-antibody