DNASU Plasmid Repository • 480.965.5697 | Email

SOCS1 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOCS1
Gene Name:  suppressor of cytokine signaling 1
Sequence             
Original Clone ID: FLH264893.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00080273

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 633nts         Open reading frame : 1 to 633
Reference Sequence Alignment

ATGGTAGCACACAACCAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGA
CGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGG
CCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCG
CACGCCGATTACCGGCGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTAC
TGGGGGCCCCTGAGCGTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACC
TTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCC
TCGGGACCCACGAGCATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGC
CGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGC
ATGCTGGGGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAG
CGCATCGTGGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTC
CGCGACTACCTGAGCTCCTTCCCCTTCCAGATT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 790
Start on reference sequence 155
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOCS1
Symbol Nomenclature : SOCS1
SYNONYM : CIS1; CISH1; JAB; SOCS-1; SSI-1; SSI1; TIP3
Designation : JAK binding protein|JAK-binding protein|STAT induced SH3 protein 1|STAT-induced STAT inhibitor 1|TIP-3|Tec-interacting protein 3|cytokine-inducible SH2 protein 1
Full Nomenclature : suppressor of cytokine signaling 1
GENEID : 8651
GI : 151555042
GenBank Accession : BC148542
HGNC : 19383
MIM : 603597
Vega : OTTHUMG00000129792
Target GenBank: NM_003745

 

Reference Sequence Alignment

  

HsCD00080273      ATGGTAGCACACAACCAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGA
NM_003745.1       ATGGTAGCACACAACCAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGA
                  ************************************************************

HsCD00080273      CGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGG
NM_003745.1       CGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGG
                  ************************************************************

HsCD00080273      CCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCG
NM_003745.1       CCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCG
                  ************************************************************

HsCD00080273      CACGCCGATTACCGGCGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTAC
NM_003745.1       CACGCCGATTACCGGCGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTAC
                  ************************************************************

HsCD00080273      TGGGGGCCCCTGAGCGTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACC
NM_003745.1       TGGGGGCCCCTGAGCGTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACC
                  ************************************************************

HsCD00080273      TTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCC
NM_003745.1       TTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCC
                  ************************************************************

HsCD00080273      TCGGGACCCACGAGCATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGC
NM_003745.1       TCGGGACCCACGAGCATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGC
                  ************************************************************

HsCD00080273      CGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGC
NM_003745.1       CGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGC
                  ************************************************************

HsCD00080273      ATGCTGGGGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAG
NM_003745.1       ATGCTGGGGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAG
                  ************************************************************

HsCD00080273      CGCATCGTGGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTC
NM_003745.1       CGCATCGTGGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTC
                  ************************************************************

HsCD00080273      CGCGACTACCTGAGCTCCTTCCCCTTCCAGATT---
NM_003745.1       CGCGACTACCTGAGCTCCTTCCCCTTCCAGATTTGA
                  *********************************   

Pathways

NCI : IFN-gamma pathway
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL4-mediated signaling events
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
Panther : JAK/STAT signaling pathway
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Regulation of KIT signaling
Reactome : Signal Transduction
Reactome : Signaling by SCF-KIT
WikiPathway : Adipogenesis
WikiPathway : EPO Receptor Signaling
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Type II interferon signaling (IFNG)

Protein

SMART domain : SOCS : suppressors of cytokine signalling
SMART domain : SOCS_box :
SMART domain : SH2 : Src homology 2 domains
UniProt : O15524
UniProt : Q4JHT5
HPRD : 04669

Clone

Cloning Information : 264893
HIP Master Clone ID : 196991
IMAGE ID : 100015498
Original Clone ID : FLH264893.01L

Organism


TAX_ID : 9606
Species Specific ID: 8651

Genome

Chromosome : 16
Map Location : 16p13.13
Ensembl : ENSG00000185338

Reagents

Labome : SOCS1-antibody