DNASU Plasmid Repository • 480.965.5697 | Email

NRAS (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NRAS
Gene Name:  neuroblastoma RAS viral (v-ras) oncogene homolog
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008023.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000804

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 570nts         Open reading frame : 1 to 570
Reference Sequence Alignment

ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCACTGACA
ATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGGATTCTTAC
AGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGA
CAAGAAGAGTACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGT
GTATTTGCCATCAATAATAGCAAGTCATTTGCGGATATTAACCTCTACAGGGAGCAGATT
AAGCGAGTAAAAGACTCGGATGATGTACCTATGGTGCTAGTGGGAAACAAGTGTGATTTG
CCAACAAGGACAGTTGATACAAAACAAGCCCACGAACTGGCCAAGAGTTACGGGATTCCA
TTCATTGAAACCTCAGCCAAGACCAGACAGGGTGTTGAAGATGCTTTTTACACACTGGTA
AGAGAAATACGCCAGTACCGAATGAAAAAACTCAACAGCAGTGATGATGGGACTCAGGGT
TGTATGGGATTGCCATGTGTGGTGATGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 823
Start on reference sequence 254
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NRAS
Symbol Nomenclature : NRAS
SYNONYM : ALPS4; N-ras; NRAS1; NS6
Designation : GTPase NRas|N-ras protein part 4|transforming protein N-Ras|v-ras neuroblastoma RAS viral oncogene homolog
Full Nomenclature : neuroblastoma RAS viral (v-ras) oncogene homolog
GENEID : 4893
Locus Tag : RP5-1000E10.2
GI : 61357185
GenBank Accession : AY888404
HGNC : 7989
MIM : 164790
Vega : OTTHUMG00000012059
Target GenBank: NM_002524

 

Reference Sequence Alignment

  

HsCD00000804      ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCACTGACA
NM_002524.4       ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCACTGACA
                  ************************************************************

HsCD00000804      ATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGGATTCTTAC
NM_002524.4       ATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGGATTCTTAC
                  ************************************************************

HsCD00000804      AGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGA
NM_002524.4       AGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGA
                  ************************************************************

HsCD00000804      CAAGAAGAGTACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGT
NM_002524.4       CAAGAAGAGTACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGT
                  ************************************************************

HsCD00000804      GTATTTGCCATCAATAATAGCAAGTCATTTGCGGATATTAACCTCTACAGGGAGCAGATT
NM_002524.4       GTATTTGCCATCAATAATAGCAAGTCATTTGCGGATATTAACCTCTACAGGGAGCAGATT
                  ************************************************************

HsCD00000804      AAGCGAGTAAAAGACTCGGATGATGTACCTATGGTGCTAGTGGGAAACAAGTGTGATTTG
NM_002524.4       AAGCGAGTAAAAGACTCGGATGATGTACCTATGGTGCTAGTGGGAAACAAGTGTGATTTG
                  ************************************************************

HsCD00000804      CCAACAAGGACAGTTGATACAAAACAAGCCCACGAACTGGCCAAGAGTTACGGGATTCCA
NM_002524.4       CCAACAAGGACAGTTGATACAAAACAAGCCCACGAACTGGCCAAGAGTTACGGGATTCCA
                  ************************************************************

HsCD00000804      TTCATTGAAACCTCAGCCAAGACCAGACAGGGTGTTGAAGATGCTTTTTACACACTGGTA
NM_002524.4       TTCATTGAAACCTCAGCCAAGACCAGACAGGGTGTTGAAGATGCTTTTTACACACTGGTA
                  ************************************************************

HsCD00000804      AGAGAAATACGCCAGTACCGAATGAAAAAACTCAACAGCAGTGATGATGGGACTCAGGGT
NM_002524.4       AGAGAAATACGCCAGTACCGAATGAAAAAACTCAACAGCAGTGATGATGGGACTCAGGGT
                  ************************************************************

HsCD00000804      TGTATGGGATTGCCATGTGTGGTGATGTAG
NM_002524.4       TGTATGGGATTGCCATGTGTGGTGATGTAA
                  *****************************.

Pathways

NCI : C-MYB transcription factor network
NCI : CXCR3-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Downstream signaling in naïve CD8+ T cells
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHB forward signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : GMCSF-mediated signaling events
NCI : IL2-mediated signaling events
NCI : Internalization of ErbB1
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Ras family activation
NCI : SHP2 signaling
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : mTOR signaling pathway
Panther : Angiogenesis
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : TGF-beta signaling pathway
Panther : VEGF signaling pathway
Panther : p53 pathway feedback loops 2
Reactome : ARMS-mediated activation
Reactome : Activation of RAS in B cells
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Cell surface interactions at the vascular wall
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : MEK activation
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : SHC-mediated cascade
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Tie2 Signaling
Reactome : p38MAPK events
WikiPathway : G Protein Signaling Pathways
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 8023
HIP Master Clone ID : 7581
Original Clone ID : FLH008023.01X

Organism


TAX_ID : 9606
Species Specific ID: 4893

Genome

Chromosome : 1
Map Location : 1p13.2
Ensembl : ENSG00000213281

Reagents

Labome : NRAS-antibody