DNASU Plasmid Repository • 480.965.5697 | Email

ZBTB20 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ZBTB20
Gene Name:  zinc finger and BTB domain containing 20
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH265182.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00080561

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2004nts         Open reading frame : 1 to 2004
Reference Sequence Alignment

ATGACCGAGCGCATTCACAGCATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACC
CTCAACGAGCAGCGCAACCGTGGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGC
ATGCTGCGCGCACACCGCTGCGTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTG
CTGCTTGGCTACAGCGACATCGAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAG
CTCATTGACTTCATGTACAGCGGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATC
CTCACGGCCGCCAGCATCCTGCAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTG
TCACAGAACGTGGGCGATGTGTTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGG
GGCACTCCCGAGTCAGGCACGTCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAG
AGCCACCCACAGCACAGCGTGGACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAG
AATGGCAGCGGCGAGCGCTCTTTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCG
CTCGGCCTGCCCCGCGACCACCACATGGAAGACCCCAGCTGGATCACACGCATCCATGAG
CGCTCGCAGCAGATGGAGCGCTACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAG
CAGCCCCGGCCTGTGCGCATCCAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATG
GAGGACGATTACGACTACTACGGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCC
GAGGAGTGCACGGAAGACACAGACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAA
AGCTTCGACTCGGGCGTCAGCTCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAG
TTTGGGCCTGGGGCGGCGCGGGACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCA
GAAGCCCCCGCTGAGGGTGGTCCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCG
GAGAGAAGCAATGAAGTGGAGATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGAC
AAGAGCGTCCTACAACAGCCTTCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACC
CAGCTCTACTTACGCCAGACAGAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTG
ACCAGCAACACGCAGGTCATTGGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACT
ACCCAGCCCGCGGGCAGTGGCCCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCA
GGCCAGCAGACCCAGTTTGTGACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAG
CTGCCAGCGCCACAGCCCCTGGCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGC
GAAAAAAAGCCTTATGAGTGCACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTAC
GTCAAGCACATGTTCGTACACACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGC
TCCTTCTCCTTAAAGGATTACCTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCA
TACCAGTGTAGTATCTGCAACAAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATG
CGCCTCCACCGGGGAGAGAAGTCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCAC
AAGACCCTCCTGGAGCGACACGTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCA
GGCACACCCCCAGGTGCCCGCGCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACC
ACTTACGTCTGCTCCGTCTGCCCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCAC
ATGAGGATGCATGTGTCTGACGGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2495
Start on reference sequence 489
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagctggcaCC

3' Linker Sequence:
GGCGacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ZBTB20
Symbol Nomenclature : ZBTB20
SYNONYM : DPZF; HOF; ODA-8S; RP11-553L6.5; ZNF288
Designation : BTB/POZ zinc finger protein DPZF|dendritic cell-derived BTB/POZ zinc finger|dendritic-derived BTB/POZ zinc finger protein|zinc finger and BTB domain-containing protein 20|zinc finger protein 288
Full Nomenclature : zinc finger and BTB domain containing 20
GENEID : 26137
GI : 117646721
GenBank Accession : AM392598
HGNC : 13503
MIM : 606025
Vega : OTTHUMG00000159366
Target GenBank: AL050276

 

Reference Sequence Alignment

  

HsCD00080561        ------------------------------------------------------------
NM_001164343.1      ------------------------------------------------------------
NM_001164347.1      ------------------------------------------------------------
XM_005247342.1      ------------------------------------------------------------
XM_005247341.1      ATGCTAGAACGGAAGAAACCCAAGACAGCTGAAAACCAGAAGGCATCTGAGGAGAATGAG
NM_001164345.1      ------------------------------------------------------------
XM_005247340.1      ATGCTAGAACGGAAGAAACCCAAGACAGCTGAAAACCAGAAGGCATCTGAGGAGAATGAG
XM_005247343.1      ------------------------------------------------------------
NM_015642.4         ------------------------------------------------------------
NM_001164344.1      ------------------------------------------------------------
NM_001164342.1      ATGCTAGAACGGAAGAAACCCAAGACAGCTGAAAACCAGAAGGCATCTGAGGAGAATGAG
XM_005247339.1      ATGCTAGAACGGAAGAAACCCAAGACAGCTGAAAACCAGAAGGCATCTGAGGAGAATGAG
NM_001164346.1      ------------------------------------------------------------
                                                                                

HsCD00080561        ------------------------------------------------------------
NM_001164343.1      ------------------------------------------------------------
NM_001164347.1      ------------------------------------------------------------
XM_005247342.1      ------------------------------------------------------------
XM_005247341.1      ATTACTCAGCCGGGTGGATCCAGCGCCAAGCCGGGCCTTCCCTGCCTGAACTTTGAAGCT
NM_001164345.1      ------------------------------------------------------------
XM_005247340.1      ATTACTCAGCCGGGTGGATCCAGCGCCAAGCCGGGCCTTCCCTGCCTGAACTTTGAAGCT
XM_005247343.1      ------------------------------------------------------------
NM_015642.4         ------------------------------------------------------------
NM_001164344.1      ------------------------------------------------------------
NM_001164342.1      ATTACTCAGCCGGGTGGATCCAGCGCCAAGCCGGGCCTTCCCTGCCTGAACTTTGAAGCT
XM_005247339.1      ATTACTCAGCCGGGTGGATCCAGCGCCAAGCCGGGCCTTCCCTGCCTGAACTTTGAAGCT
NM_001164346.1      ------------------------------------------------------------
                                                                                

HsCD00080561        ------------------------------------------------------------
NM_001164343.1      ------------------------------------------------------------
NM_001164347.1      ------------------------------------------------------------
XM_005247342.1      ------------------------------------------------------------
XM_005247341.1      GTTTTGTCTCCAGACCCAGCCCTCATCCACTCAACACATTCACTGACAAACTCTCACGCT
NM_001164345.1      ------------------------------------------------------------
XM_005247340.1      GTTTTGTCTCCAGACCCAGCCCTCATCCACTCAACACATTCACTGACAAACTCTCACGCT
XM_005247343.1      ------------------------------------------------------------
NM_015642.4         ------------------------------------------------------------
NM_001164344.1      ------------------------------------------------------------
NM_001164342.1      GTTTTGTCTCCAGACCCAGCCCTCATCCACTCAACACATTCACTGACAAACTCTCACGCT
XM_005247339.1      GTTTTGTCTCCAGACCCAGCCCTCATCCACTCAACACATTCACTGACAAACTCTCACGCT
NM_001164346.1      ------------------------------------------------------------
                                                                                

HsCD00080561        ---------------------------------------ATGACCGAGCGCATTCACAGC
NM_001164343.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
NM_001164347.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
XM_005247342.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
XM_005247341.1      CACACCGGGTCATCTGATTGTGACATCAGTTGCAAGGGGATGACCGAGCGCATTCACAGC
NM_001164345.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
XM_005247340.1      CACACCGGGTCATCTGATTGTGACATCAGTTGCAAGGGGATGACCGAGCGCATTCACAGC
XM_005247343.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
NM_015642.4         ---------------------------------------ATGACCGAGCGCATTCACAGC
NM_001164344.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
NM_001164342.1      CACACCGGGTCATCTGATTGTGACATCAGTTGCAAGGGGATGACCGAGCGCATTCACAGC
XM_005247339.1      CACACCGGGTCATCTGATTGTGACATCAGTTGCAAGGGGATGACCGAGCGCATTCACAGC
NM_001164346.1      ---------------------------------------ATGACCGAGCGCATTCACAGC
                                                           *********************

HsCD00080561        ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_001164343.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_001164347.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
XM_005247342.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
XM_005247341.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_001164345.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
XM_005247340.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
XM_005247343.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_015642.4         ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_001164344.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_001164342.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
XM_005247339.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
NM_001164346.1      ATCAACCTTCACAACTTCAGCAATTCCGTGCTCGAGACCCTCAACGAGCAGCGCAACCGT
                    ************************************************************

HsCD00080561        GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_001164343.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_001164347.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
XM_005247342.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
XM_005247341.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_001164345.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
XM_005247340.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
XM_005247343.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_015642.4         GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_001164344.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_001164342.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
XM_005247339.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
NM_001164346.1      GGCCACTTCTGTGACGTAACGGTGCGCATCCACGGGAGCATGCTGCGCGCACACCGCTGC
                    ************************************************************

HsCD00080561        GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_001164343.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_001164347.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
XM_005247342.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
XM_005247341.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_001164345.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
XM_005247340.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
XM_005247343.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_015642.4         GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_001164344.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_001164342.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
XM_005247339.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
NM_001164346.1      GTGCTGGCAGCCGGCAGCCCCTTCTTCCAGGACAAACTGCTGCTTGGCTACAGCGACATC
                    ************************************************************

HsCD00080561        GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_001164343.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_001164347.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
XM_005247342.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
XM_005247341.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_001164345.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
XM_005247340.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
XM_005247343.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_015642.4         GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_001164344.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_001164342.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
XM_005247339.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
NM_001164346.1      GAGATCCCGTCGGTGGTGTCAGTGCAGTCAGTGCAAAAGCTCATTGACTTCATGTACAGC
                    ************************************************************

HsCD00080561        GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_001164343.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_001164347.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
XM_005247342.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
XM_005247341.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_001164345.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
XM_005247340.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
XM_005247343.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_015642.4         GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_001164344.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_001164342.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
XM_005247339.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
NM_001164346.1      GGCGTGCTACGGGTCTCGCAGTCGGAAGCTCTGCAGATCCTCACGGCCGCCAGCATCCTG
                    ************************************************************

HsCD00080561        CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_001164343.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_001164347.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
XM_005247342.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
XM_005247341.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_001164345.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
XM_005247340.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
XM_005247343.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_015642.4         CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_001164344.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_001164342.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
XM_005247339.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
NM_001164346.1      CAGATCAAAACAGTCATCGACGAGTGCACGCGCATCGTGTCACAGAACGTGGGCGATGTG
                    ************************************************************

HsCD00080561        TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_001164343.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_001164347.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
XM_005247342.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
XM_005247341.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_001164345.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
XM_005247340.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
XM_005247343.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_015642.4         TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_001164344.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_001164342.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
XM_005247339.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
NM_001164346.1      TTCCCGGGGATCCAGGACTCGGGCCAGGACACGCCGCGGGGCACTCCCGAGTCAGGCACG
                    ************************************************************

HsCD00080561        TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_001164343.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_001164347.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
XM_005247342.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
XM_005247341.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_001164345.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
XM_005247340.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
XM_005247343.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_015642.4         TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_001164344.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_001164342.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
XM_005247339.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
NM_001164346.1      TCAGGCCAGAGCAGCGACACGGAGTCGGGCTACCTGCAGAGCCACCCACAGCACAGCGTG
                    ************************************************************

HsCD00080561        GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_001164343.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_001164347.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
XM_005247342.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
XM_005247341.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_001164345.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
XM_005247340.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
XM_005247343.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_015642.4         GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_001164344.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_001164342.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
XM_005247339.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
NM_001164346.1      GACAGGATCTACTCGGCACTCTACGCGTGCTCCATGCAGAATGGCAGCGGCGAGCGCTCT
                    ************************************************************

HsCD00080561        TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_001164343.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_001164347.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
XM_005247342.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
XM_005247341.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_001164345.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
XM_005247340.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
XM_005247343.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_015642.4         TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_001164344.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_001164342.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
XM_005247339.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
NM_001164346.1      TTTTACAGCGGCGCAGTGGTCAGCCACCACGAGACTGCGCTCGGCCTGCCCCGCGACCAC
                    ************************************************************

HsCD00080561        CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_001164343.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_001164347.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
XM_005247342.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
XM_005247341.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_001164345.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
XM_005247340.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
XM_005247343.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_015642.4         CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_001164344.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_001164342.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
XM_005247339.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
NM_001164346.1      CACATGGAAGACCCCAGCTGGATCACACGCATCCATGAGCGCTCGCAGCAGATGGAGCGC
                    ************************************************************

HsCD00080561        TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_001164343.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_001164347.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
XM_005247342.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
XM_005247341.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_001164345.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
XM_005247340.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
XM_005247343.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_015642.4         TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_001164344.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_001164342.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
XM_005247339.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
NM_001164346.1      TACCTGTCCACCACCCCCGAGACCACGCACTGCCGCAAGCAGCCCCGGCCTGTGCGCATC
                    ************************************************************

HsCD00080561        CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_001164343.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_001164347.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
XM_005247342.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
XM_005247341.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_001164345.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
XM_005247340.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
XM_005247343.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_015642.4         CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_001164344.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_001164342.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
XM_005247339.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
NM_001164346.1      CAGACCCTAGTGGGCAACATCCACATCAAGCAGGAGATGGAGGACGATTACGACTACTAC
                    ************************************************************

HsCD00080561        GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_001164343.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_001164347.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
XM_005247342.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
XM_005247341.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_001164345.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
XM_005247340.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
XM_005247343.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_015642.4         GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_001164344.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_001164342.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
XM_005247339.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
NM_001164346.1      GGGCAGCAAAGGGTGCAGATCCTGGAACGCAACGAATCCGAGGAGTGCACGGAAGACACA
                    ************************************************************

HsCD00080561        GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_001164343.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_001164347.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
XM_005247342.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
XM_005247341.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_001164345.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
XM_005247340.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
XM_005247343.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_015642.4         GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_001164344.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_001164342.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
XM_005247339.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
NM_001164346.1      GACCAGGCCGAGGGCACCGAGAGTGAGCCCAAAGGTGAAAGCTTCGACTCGGGCGTCAGC
                    ************************************************************

HsCD00080561        TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_001164343.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_001164347.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
XM_005247342.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
XM_005247341.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_001164345.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
XM_005247340.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
XM_005247343.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_015642.4         TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_001164344.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_001164342.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
XM_005247339.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
NM_001164346.1      TCCTCCATAGGCACCGAGCCTGACTCGGTGGAGCAGCAGTTTGGGCCTGGGGCGGCGCGG
                    ************************************************************

HsCD00080561        GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_001164343.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_001164347.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
XM_005247342.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
XM_005247341.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_001164345.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
XM_005247340.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
XM_005247343.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_015642.4         GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_001164344.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_001164342.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
XM_005247339.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
NM_001164346.1      GACAGCCAGGCTGAACCCACCCAACCCGAGCAGGCTGCAGAAGCCCCCGCTGAGGGTGGT
                    ************************************************************

HsCD00080561        CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_001164343.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_001164347.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
XM_005247342.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
XM_005247341.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_001164345.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
XM_005247340.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
XM_005247343.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_015642.4         CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_001164344.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_001164342.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
XM_005247339.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
NM_001164346.1      CCGCAGACAAACCAGCTAGAAACAGGTGCTTCCTCTCCGGAGAGAAGCAATGAAGTGGAG
                    ************************************************************

HsCD00080561        ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_001164343.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_001164347.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
XM_005247342.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
XM_005247341.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_001164345.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
XM_005247340.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
XM_005247343.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_015642.4         ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_001164344.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_001164342.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
XM_005247339.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
NM_001164346.1      ATGGACAGCACTGTTATCACTGTCAGCAACAGCTCCGACAAGAGCGTCCTACAACAGCCT
                    ************************************************************

HsCD00080561        TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_001164343.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_001164347.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
XM_005247342.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
XM_005247341.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_001164345.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
XM_005247340.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
XM_005247343.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_015642.4         TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_001164344.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_001164342.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
XM_005247339.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
NM_001164346.1      TCGGTCAACACGTCCATCGGGCAGCCATTGCCAAGTACCCAGCTCTACTTACGCCAGACA
                    ************************************************************

HsCD00080561        GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_001164343.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_001164347.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
XM_005247342.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
XM_005247341.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_001164345.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
XM_005247340.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
XM_005247343.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_015642.4         GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_001164344.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_001164342.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
XM_005247339.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
NM_001164346.1      GAAACCCTCACCAGCAACCTGAGGATGCCTCTGACCTTGACCAGCAACACGCAGGTCATT
                    ************************************************************

HsCD00080561        GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_001164343.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_001164347.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
XM_005247342.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
XM_005247341.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_001164345.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
XM_005247340.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
XM_005247343.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_015642.4         GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_001164344.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_001164342.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
XM_005247339.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
NM_001164346.1      GGCACAGCTGGCAACACCTACCTGCCAGCCCTCTTCACTACCCAGCCCGCGGGCAGTGGC
                    ************************************************************

HsCD00080561        CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_001164343.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_001164347.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
XM_005247342.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
XM_005247341.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_001164345.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
XM_005247340.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
XM_005247343.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_015642.4         CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_001164344.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_001164342.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
XM_005247339.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
NM_001164346.1      CCCAAGCCTTTCCTCTTCAGCCTGCCACAGCCCCTGGCAGGCCAGCAGACCCAGTTTGTG
                    ************************************************************

HsCD00080561        ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_001164343.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_001164347.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
XM_005247342.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
XM_005247341.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_001164345.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
XM_005247340.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
XM_005247343.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_015642.4         ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_001164344.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_001164342.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
XM_005247339.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
NM_001164346.1      ACAGTGTCCCAGCCCGGTCTGTCGACCTTTACTGCACAGCTGCCAGCGCCACAGCCCCTG
                    ************************************************************

HsCD00080561        GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_001164343.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_001164347.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
XM_005247342.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
XM_005247341.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_001164345.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
XM_005247340.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
XM_005247343.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_015642.4         GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_001164344.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_001164342.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
XM_005247339.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
NM_001164346.1      GCCTCATCCGCAGGCCACAGCACAGCCAGTGGGCAAGGCGAAAAAAAGCCTTATGAGTGC
                    ************************************************************

HsCD00080561        ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_001164343.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_001164347.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
XM_005247342.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
XM_005247341.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_001164345.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
XM_005247340.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
XM_005247343.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_015642.4         ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_001164344.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_001164342.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
XM_005247339.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
NM_001164346.1      ACTCTCTGCAACAAGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACAC
                    ************************************************************

HsCD00080561        ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_001164343.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_001164347.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
XM_005247342.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
XM_005247341.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_001164345.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
XM_005247340.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
XM_005247343.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_015642.4         ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_001164344.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_001164342.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
XM_005247339.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
NM_001164346.1      ACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTAC
                    ************************************************************

HsCD00080561        CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_001164343.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_001164347.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
XM_005247342.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
XM_005247341.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_001164345.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
XM_005247340.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
XM_005247343.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_015642.4         CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_001164344.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_001164342.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
XM_005247339.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
NM_001164346.1      CTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAAC
                    ************************************************************

HsCD00080561        AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_001164343.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_001164347.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
XM_005247342.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
XM_005247341.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_001164345.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
XM_005247340.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
XM_005247343.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_015642.4         AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_001164344.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_001164342.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
XM_005247339.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
NM_001164346.1      AAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAG
                    ************************************************************

HsCD00080561        TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_001164343.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_001164347.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
XM_005247342.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
XM_005247341.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_001164345.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
XM_005247340.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
XM_005247343.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_015642.4         TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_001164344.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_001164342.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
XM_005247339.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
NM_001164346.1      TCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACAC
                    ************************************************************

HsCD00080561        GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_001164343.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_001164347.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
XM_005247342.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
XM_005247341.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_001164345.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
XM_005247340.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
XM_005247343.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_015642.4         GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_001164344.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_001164342.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
XM_005247339.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
NM_001164346.1      GTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGC
                    ************************************************************

HsCD00080561        GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_001164343.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_001164347.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
XM_005247342.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
XM_005247341.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_001164345.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
XM_005247340.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
XM_005247343.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_015642.4         GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_001164344.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_001164342.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
XM_005247339.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
NM_001164346.1      GCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGC
                    ************************************************************

HsCD00080561        CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_001164343.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_001164347.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
XM_005247342.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
XM_005247341.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_001164345.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
XM_005247340.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
XM_005247343.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_015642.4         CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_001164344.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_001164342.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
XM_005247339.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
NM_001164346.1      CCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGACCACATGAGGATGCATGTGTCTGAC
                    ************************************************************

HsCD00080561        GGA---
NM_001164343.1      GGATAA
NM_001164347.1      GGATAA
XM_005247342.1      GGATAA
XM_005247341.1      GGATAA
NM_001164345.1      GGATAA
XM_005247340.1      GGATAA
XM_005247343.1      GGATAA
NM_015642.4         GGATAA
NM_001164344.1      GGATAA
NM_001164342.1      GGATAA
XM_005247339.1      GGATAA
NM_001164346.1      GGATAA
                    ***   

Protein

SMART domain : ZnF_C2H2 : zinc finger
SMART domain : BTB : Broad-Complex, Tramtrack and Bric a brac
UniProt : Q9HC78
UniProt : B2RCW4
UniProt : A8K251
HPRD : 05822

Clone

Cloning Information : 265182
HIP Master Clone ID : 197280
IMAGE ID : 100001797
Original Clone ID : FLH265182.01L

Organism


TAX_ID : 9606
Species Specific ID: 26137

Genome

Chromosome : 3
Map Location : 3q13.2
Ensembl : ENSG00000181722

Reagents

Labome : DPZF-antibody