DNASU Plasmid Repository • 480.965.5697 | Email

SOS1 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOS1
Gene Name:  son of sevenless homolog 1 (Drosophila)
Sequence             
Original Clone ID: FLH265857.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00081233

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3999nts         Open reading frame : 1 to 3999
Reference Sequence Alignment

ATGCAGGCGCAGCAGCTGCCCTACGAGTTTTTCAGCGAAGAGAACGCGCCCAAGTGGCGG
GGACTACTGGTGCCTGCGCTGAAAAAGGTCCAGGGGCAAGTTCATCCTACTCTCGAGTCT
AATGATGATGCTCTTCAGTATGTTGAAGAATTAATTTTGCAATTATTAAATATGCTATGC
CAAGCTCAGCCCCGAAGTGCTTCAGATGTAGAGGAACGTGTTCAAAAAAGTTTCCCTCAT
CCAATTGATAAATGGGCAATAGCTGATGCCCAATCAGCTATTGAAAAGAGGAAGCGAAGA
AACCCTTTATCTCTCCCAGTAGAAAAAATTCATCCTTTATTAAAGGAGGTCCTAGGTTAT
AAAATTGACCACCAGGTTTCTGTTTACATAGTAGCAGTCTTAGAATACATTTCTGCAGAC
ATTTTAAAGCTGGTTGGGAATTATGTAAGAAATATACGGCATTATGAAATTACAAAACAA
GATATTAAAGTGGCAATGTGTGCTGACAAGGTATTGATGGATATGTTTCATCAAGATGTA
GAAGATATTAATATATTATCTTTAACTGACGAAGAGCCTTCCACCTCAGGAGAACAAACT
TACTATGATTTGGTAAAAGCATTTATGGCAGAAATTCGACAATATATAAGGGAACTAAAT
CTAATTATAAAAGTTTTTAGAGAGCCCTTTGTCTCCAATTCAAAATTGTTTTCAGCTAAT
GATGTAGAAAATATATTTAGTCGCATAGTAGATATACATGAACTTAGTGTAAAGTTACTG
GGCCATATAGAAGATACAGTAGAAATGACAGATGAAGGCAGTCCCCATCCACTAGTAGGA
AGCTGCTTTGAAGACTTAGCAGAGGAACTGGCATTTGATCCATATGAATCGTATGCTCGA
GATATTTTGCGACCTGGTTTTCATGATCGTTTCCTTAGTCAGTTATCAAAGCCTGGGGCA
GCACTTTATTTGCAGTCAATAGGCGAAGGTTTCAAAGAAGCTGTTCAATATGTTTTACCC
AGGCTGCTTCTGGCCCCTGTTTACCACTGTCTCCATTACTTTGAACTTTTGAAGCAGTTA
GAAGAAAAAAGTGAAGATCAAGAAGACAAGGAATGTTTAAAACAAGCAATAACAGCTTTG
CTTAATGTTCAGAGTGGTATGGAAAAAATATGTTCTAAAAGTCTTGCAAAACGAAGACTG
AGTGAATCTGCATGTCGGTTTTATAGTCAGCAAATGAAGGGGAAACAACTAGCAATCAAG
AAGATGAACGAGATTCAGAAGAATATTGATGGTTGGGAGGGAAAAGACATTGGACAGTGT
TGTAATGAATTTATAATGGAAGGAACTCTTACACGTGTAGGAGCCAAACATGAGAGACAC
ATATTTCTCTTTGATGGCTTAATGATTTGCTGTAAATCAAATCATGGGCAGCCAAGACTT
CCTGGTGCTAGCAATGCAGAATATCGTCTTAAAGAAAAGTTTTTTATGCGAAAGGTACAA
ATTAATGATAAAGATGACACCAATGAATACAAGCATGCTTTTGAAATAATTTTAAAAGAT
GAAAATAGTGTTATATTTTCTGCCAAGTCAGCTGAAGAGAAAAACAATTGGATGGCAGCA
TTGATATCTTTACAGTACCGGAGTACACTGGAAAGGATGCTTGATGTAACAATGCTACAG
GAAGAGAAAGAGGAGCAGATGAGGCTGCCTAGTGCTGATGTTTATAGATTTGCAGAGCCT
GACTCTGAAGAGAATATTATATTTGAAGAGAACATGCAGCCCAAGGCTGGAATTCCAATT
ATCAAAGCAGGAACTGTTATTAAACTTATAGAGAGGCTTACGTACCATATGTACGCAGAT
CCCAATTTTGTTCGGACATTTCTTACAACATACAGATCCTTTTGCAAACCTCAAGAACTA
CTGAGTCTTATAATAGAAAGGTTTGAAATTCCAGAGCCTGAGCCAACAGAAGCTGATCGC
ATAGCTATAGAGAATGGAGATCAACCCTTGAGTGCAGAACTGAAAAGATTTAGAAAAGAA
TATATACAGCCTGTGCAACTGCGAGTATTAAATGTATGTCGGCACTGGGTAGAGCACCAC
TTCTATGATTTTGAAAGAGATGCATATCTTTTGCAACGAATGGAAGAATTTATTGGAACA
GTAAGAGGTAAAGCAATGAAAAAATGGGTTGAATCCATCACTAAAATAATCCAAAGGAAA
AAAATTGCAAGAGACAATGGACCAGGTCATAATATTACATTTCAGAGTTCACCTCCCACA
GTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACAC
CCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAG
CCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAAT
CTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTA
GAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAA
GTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCA
TCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAATT
TTAGAAGAAGCTCATGAATTGAGTGAAGATCACTATAAGAAATATTTGGCAAAACTCAGG
TCTATTAATCCACCATGTGTGCCTTTCTTTGGAATTTATCTCACTAATATCTTGAAAACA
GAAGAAGGCAACCCTGAGGTCCTAAAAAGACATGGAAAAGAGCTTATAAACTTTAGCAAA
AGGAGGAAAGTAGCAGAAATAACAGGAGAGATCCAGCAGTACCAAAATCAGCCTTACTGT
TTACGAGTAGAATCAGATATCAAAAGGTTCTTTGAAAACTTGAATCCGATGGGAAATAGC
ATGGAGAAGGAATTTACAGATTATCTTTTCAACAAATCCCTAGAAATAGAACCACGAAAC
CCTAAGCCTCTCCCAAGATTTCCAAAAAAATATAGCTATCCCCTAAAATCTCCTGGTGTT
CGTCCATCAAACCCAAGACCAGGTACCATGAGGCATCCCACACCTCTGCAGCAGGAGCCA
AGGAAAATTAGTTATAGTAGGATCCCTGAAAGTGAAACAGAAAGTACAGCATCTGCACCA
AATTCTCCAAGAACACCGTTAACACCTCCGCCTGCTTCTGGTGCTTCCAGTACCACAGAT
GTTTGCAGTGTATTTGATTCCGATCATTCGAGCCCTTTTCACTCAAGCAATGATACCGTC
TTTATCCAAGTTACTCTGCCCCATGGCCCAAGATCTGCTTCTGTATCATCTATAAGTTTA
ACCAAAGGCACTGATGAAGTGCCTGTCCCTCCTCCTGTTCCTCCACGAAGACGACCAGAA
TCTGCCCCAGCAGAATCTTCACCATCTAAGATTATGTCTAAGCATTTGGACAGTCCCCCA
GCCATTCCTCCTAGGCAACCCACATCAAAAGCCTATTCACCACGATATTCAATATCAGAC
CGGACCTCTATCTCAGACCCTCCTGAAAGCCCTCCCTTATTACCACCACGAGAACCTGTG
AGGACACCTGATGTTTTCTCAAGCTCACCACTACATCTCCAACCTCCCCCTTTGGGCAAA
AAAAGTGACCATGGCAATGCCTTCTTCCCAAACAGCCCTTCCCCCTTTACACCACCTCCT
CCTCAAACACCTTCTCCTCACGGCACAAGAAGGCATCTGCCATCACCACCATTGACACAA
GAAGTGGACCTTCATTCCATTGCTGGGCCGCCTGTTCCTCCACGACAAAGCACTTCTCAA
CATATCCCTAAACTCCCTCCAAAAACTTACAAAAGGGAGCACACACACCCATCCATGCAC
AGAGATGGACCACCACTGTTGGAGAATGCCCATTCTTCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 4002
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOS1
Symbol Nomenclature : SOS1
SYNONYM : GF1; GGF1; GINGF; HGF; NS4
Designation : SOS-1|gingival fibromatosis, hereditary, 1|guanine nucleotide exchange factor|son of sevenless homolog 1
Full Nomenclature : son of sevenless homolog 1 (Drosophila)
GENEID : 6654
GI : 147897728
GenBank Accession : BC140215
HGNC : 11187
MIM : 182530
Vega : OTTHUMG00000102109
Target GenBank: NM_005633

 

Reference Sequence Alignment

  

HsCD00081233      ATGCAGGCGCAGCAGCTGCCCTACGAGTTTTTCAGCGAAGAGAACGCGCCCAAGTGGCGG
NM_005633.3       ATGCAGGCGCAGCAGCTGCCCTACGAGTTTTTCAGCGAAGAGAACGCGCCCAAGTGGCGG
                  ************************************************************

HsCD00081233      GGACTACTGGTGCCTGCGCTGAAAAAGGTCCAGGGGCAAGTTCATCCTACTCTCGAGTCT
NM_005633.3       GGACTACTGGTGCCTGCGCTGAAAAAGGTCCAGGGGCAAGTTCATCCTACTCTCGAGTCT
                  ************************************************************

HsCD00081233      AATGATGATGCTCTTCAGTATGTTGAAGAATTAATTTTGCAATTATTAAATATGCTATGC
NM_005633.3       AATGATGATGCTCTTCAGTATGTTGAAGAATTAATTTTGCAATTATTAAATATGCTATGC
                  ************************************************************

HsCD00081233      CAAGCTCAGCCCCGAAGTGCTTCAGATGTAGAGGAACGTGTTCAAAAAAGTTTCCCTCAT
NM_005633.3       CAAGCTCAGCCCCGAAGTGCTTCAGATGTAGAGGAACGTGTTCAAAAAAGTTTCCCTCAT
                  ************************************************************

HsCD00081233      CCAATTGATAAATGGGCAATAGCTGATGCCCAATCAGCTATTGAAAAGAGGAAGCGAAGA
NM_005633.3       CCAATTGATAAATGGGCAATAGCTGATGCCCAATCAGCTATTGAAAAGAGGAAGCGAAGA
                  ************************************************************

HsCD00081233      AACCCTTTATCTCTCCCAGTAGAAAAAATTCATCCTTTATTAAAGGAGGTCCTAGGTTAT
NM_005633.3       AACCCTTTATCTCTCCCAGTAGAAAAAATTCATCCTTTATTAAAGGAGGTCCTAGGTTAT
                  ************************************************************

HsCD00081233      AAAATTGACCACCAGGTTTCTGTTTACATAGTAGCAGTCTTAGAATACATTTCTGCAGAC
NM_005633.3       AAAATTGACCACCAGGTTTCTGTTTACATAGTAGCAGTCTTAGAATACATTTCTGCAGAC
                  ************************************************************

HsCD00081233      ATTTTAAAGCTGGTTGGGAATTATGTAAGAAATATACGGCATTATGAAATTACAAAACAA
NM_005633.3       ATTTTAAAGCTGGTTGGGAATTATGTAAGAAATATACGGCATTATGAAATTACAAAACAA
                  ************************************************************

HsCD00081233      GATATTAAAGTGGCAATGTGTGCTGACAAGGTATTGATGGATATGTTTCATCAAGATGTA
NM_005633.3       GATATTAAAGTGGCAATGTGTGCTGACAAGGTATTGATGGATATGTTTCATCAAGATGTA
                  ************************************************************

HsCD00081233      GAAGATATTAATATATTATCTTTAACTGACGAAGAGCCTTCCACCTCAGGAGAACAAACT
NM_005633.3       GAAGATATTAATATATTATCTTTAACTGACGAAGAGCCTTCCACCTCAGGAGAACAAACT
                  ************************************************************

HsCD00081233      TACTATGATTTGGTAAAAGCATTTATGGCAGAAATTCGACAATATATAAGGGAACTAAAT
NM_005633.3       TACTATGATTTGGTAAAAGCATTTATGGCAGAAATTCGACAATATATAAGGGAACTAAAT
                  ************************************************************

HsCD00081233      CTAATTATAAAAGTTTTTAGAGAGCCCTTTGTCTCCAATTCAAAATTGTTTTCAGCTAAT
NM_005633.3       CTAATTATAAAAGTTTTTAGAGAGCCCTTTGTCTCCAATTCAAAATTGTTTTCAGCTAAT
                  ************************************************************

HsCD00081233      GATGTAGAAAATATATTTAGTCGCATAGTAGATATACATGAACTTAGTGTAAAGTTACTG
NM_005633.3       GATGTAGAAAATATATTTAGTCGCATAGTAGATATACATGAACTTAGTGTAAAGTTACTG
                  ************************************************************

HsCD00081233      GGCCATATAGAAGATACAGTAGAAATGACAGATGAAGGCAGTCCCCATCCACTAGTAGGA
NM_005633.3       GGCCATATAGAAGATACAGTAGAAATGACAGATGAAGGCAGTCCCCATCCACTAGTAGGA
                  ************************************************************

HsCD00081233      AGCTGCTTTGAAGACTTAGCAGAGGAACTGGCATTTGATCCATATGAATCGTATGCTCGA
NM_005633.3       AGCTGCTTTGAAGACTTAGCAGAGGAACTGGCATTTGATCCATATGAATCGTATGCTCGA
                  ************************************************************

HsCD00081233      GATATTTTGCGACCTGGTTTTCATGATCGTTTCCTTAGTCAGTTATCAAAGCCTGGGGCA
NM_005633.3       GATATTTTGCGACCTGGTTTTCATGATCGTTTCCTTAGTCAGTTATCAAAGCCTGGGGCA
                  ************************************************************

HsCD00081233      GCACTTTATTTGCAGTCAATAGGCGAAGGTTTCAAAGAAGCTGTTCAATATGTTTTACCC
NM_005633.3       GCACTTTATTTGCAGTCAATAGGCGAAGGTTTCAAAGAAGCTGTTCAATATGTTTTACCC
                  ************************************************************

HsCD00081233      AGGCTGCTTCTGGCCCCTGTTTACCACTGTCTCCATTACTTTGAACTTTTGAAGCAGTTA
NM_005633.3       AGGCTGCTTCTGGCCCCTGTTTACCACTGTCTCCATTACTTTGAACTTTTGAAGCAGTTA
                  ************************************************************

HsCD00081233      GAAGAAAAAAGTGAAGATCAAGAAGACAAGGAATGTTTAAAACAAGCAATAACAGCTTTG
NM_005633.3       GAAGAAAAAAGTGAAGATCAAGAAGACAAGGAATGTTTAAAACAAGCAATAACAGCTTTG
                  ************************************************************

HsCD00081233      CTTAATGTTCAGAGTGGTATGGAAAAAATATGTTCTAAAAGTCTTGCAAAACGAAGACTG
NM_005633.3       CTTAATGTTCAGAGTGGTATGGAAAAAATATGTTCTAAAAGTCTTGCAAAACGAAGACTG
                  ************************************************************

HsCD00081233      AGTGAATCTGCATGTCGGTTTTATAGTCAGCAAATGAAGGGGAAACAACTAGCAATCAAG
NM_005633.3       AGTGAATCTGCATGTCGGTTTTATAGTCAGCAAATGAAGGGGAAACAACTAGCAATCAAG
                  ************************************************************

HsCD00081233      AAGATGAACGAGATTCAGAAGAATATTGATGGTTGGGAGGGAAAAGACATTGGACAGTGT
NM_005633.3       AAGATGAACGAGATTCAGAAGAATATTGATGGTTGGGAGGGAAAAGACATTGGACAGTGT
                  ************************************************************

HsCD00081233      TGTAATGAATTTATAATGGAAGGAACTCTTACACGTGTAGGAGCCAAACATGAGAGACAC
NM_005633.3       TGTAATGAATTTATAATGGAAGGAACTCTTACACGTGTAGGAGCCAAACATGAGAGACAC
                  ************************************************************

HsCD00081233      ATATTTCTCTTTGATGGCTTAATGATTTGCTGTAAATCAAATCATGGGCAGCCAAGACTT
NM_005633.3       ATATTTCTCTTTGATGGCTTAATGATTTGCTGTAAATCAAATCATGGGCAGCCAAGACTT
                  ************************************************************

HsCD00081233      CCTGGTGCTAGCAATGCAGAATATCGTCTTAAAGAAAAGTTTTTTATGCGAAAGGTACAA
NM_005633.3       CCTGGTGCTAGCAATGCAGAATATCGTCTTAAAGAAAAGTTTTTTATGCGAAAGGTACAA
                  ************************************************************

HsCD00081233      ATTAATGATAAAGATGACACCAATGAATACAAGCATGCTTTTGAAATAATTTTAAAAGAT
NM_005633.3       ATTAATGATAAAGATGACACCAATGAATACAAGCATGCTTTTGAAATAATTTTAAAAGAT
                  ************************************************************

HsCD00081233      GAAAATAGTGTTATATTTTCTGCCAAGTCAGCTGAAGAGAAAAACAATTGGATGGCAGCA
NM_005633.3       GAAAATAGTGTTATATTTTCTGCCAAGTCAGCTGAAGAGAAAAACAATTGGATGGCAGCA
                  ************************************************************

HsCD00081233      TTGATATCTTTACAGTACCGGAGTACACTGGAAAGGATGCTTGATGTAACAATGCTACAG
NM_005633.3       TTGATATCTTTACAGTACCGGAGTACACTGGAAAGGATGCTTGATGTAACAATGCTACAG
                  ************************************************************

HsCD00081233      GAAGAGAAAGAGGAGCAGATGAGGCTGCCTAGTGCTGATGTTTATAGATTTGCAGAGCCT
NM_005633.3       GAAGAGAAAGAGGAGCAGATGAGGCTGCCTAGTGCTGATGTTTATAGATTTGCAGAGCCT
                  ************************************************************

HsCD00081233      GACTCTGAAGAGAATATTATATTTGAAGAGAACATGCAGCCCAAGGCTGGAATTCCAATT
NM_005633.3       GACTCTGAAGAGAATATTATATTTGAAGAGAACATGCAGCCCAAGGCTGGAATTCCAATT
                  ************************************************************

HsCD00081233      ATCAAAGCAGGAACTGTTATTAAACTTATAGAGAGGCTTACGTACCATATGTACGCAGAT
NM_005633.3       ATCAAAGCAGGAACTGTTATTAAACTTATAGAGAGGCTTACGTACCATATGTACGCAGAT
                  ************************************************************

HsCD00081233      CCCAATTTTGTTCGGACATTTCTTACAACATACAGATCCTTTTGCAAACCTCAAGAACTA
NM_005633.3       CCCAATTTTGTTCGGACATTTCTTACAACATACAGATCCTTTTGCAAACCTCAAGAACTA
                  ************************************************************

HsCD00081233      CTGAGTCTTATAATAGAAAGGTTTGAAATTCCAGAGCCTGAGCCAACAGAAGCTGATCGC
NM_005633.3       CTGAGTCTTATAATAGAAAGGTTTGAAATTCCAGAGCCTGAGCCAACAGAAGCTGATCGC
                  ************************************************************

HsCD00081233      ATAGCTATAGAGAATGGAGATCAACCCTTGAGTGCAGAACTGAAAAGATTTAGAAAAGAA
NM_005633.3       ATAGCTATAGAGAATGGAGATCAACCCTTGAGTGCAGAACTGAAAAGATTTAGAAAAGAA
                  ************************************************************

HsCD00081233      TATATACAGCCTGTGCAACTGCGAGTATTAAATGTATGTCGGCACTGGGTAGAGCACCAC
NM_005633.3       TATATACAGCCTGTGCAACTGCGAGTATTAAATGTATGTCGGCACTGGGTAGAGCACCAC
                  ************************************************************

HsCD00081233      TTCTATGATTTTGAAAGAGATGCATATCTTTTGCAACGAATGGAAGAATTTATTGGAACA
NM_005633.3       TTCTATGATTTTGAAAGAGATGCATATCTTTTGCAACGAATGGAAGAATTTATTGGAACA
                  ************************************************************

HsCD00081233      GTAAGAGGTAAAGCAATGAAAAAATGGGTTGAATCCATCACTAAAATAATCCAAAGGAAA
NM_005633.3       GTAAGAGGTAAAGCAATGAAAAAATGGGTTGAATCCATCACTAAAATAATCCAAAGGAAA
                  ************************************************************

HsCD00081233      AAAATTGCAAGAGACAATGGACCAGGTCATAATATTACATTTCAGAGTTCACCTCCCACA
NM_005633.3       AAAATTGCAAGAGACAATGGACCAGGTCATAATATTACATTTCAGAGTTCACCTCCCACA
                  ************************************************************

HsCD00081233      GTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACAC
NM_005633.3       GTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACAC
                  ************************************************************

HsCD00081233      CCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAG
NM_005633.3       CCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAG
                  ************************************************************

HsCD00081233      CCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAAT
NM_005633.3       CCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAAT
                  ************************************************************

HsCD00081233      CTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTA
NM_005633.3       CTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTA
                  ************************************************************

HsCD00081233      GAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAA
NM_005633.3       GAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAA
                  ************************************************************

HsCD00081233      GTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCA
NM_005633.3       GTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCA
                  ************************************************************

HsCD00081233      TCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAATT
NM_005633.3       TCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAATT
                  ************************************************************

HsCD00081233      TTAGAAGAAGCTCATGAATTGAGTGAAGATCACTATAAGAAATATTTGGCAAAACTCAGG
NM_005633.3       TTAGAAGAAGCTCATGAATTGAGTGAAGATCACTATAAGAAATATTTGGCAAAACTCAGG
                  ************************************************************

HsCD00081233      TCTATTAATCCACCATGTGTGCCTTTCTTTGGAATTTATCTCACTAATATCTTGAAAACA
NM_005633.3       TCTATTAATCCACCATGTGTGCCTTTCTTTGGAATTTATCTCACTAATATCTTGAAAACA
                  ************************************************************

HsCD00081233      GAAGAAGGCAACCCTGAGGTCCTAAAAAGACATGGAAAAGAGCTTATAAACTTTAGCAAA
NM_005633.3       GAAGAAGGCAACCCTGAGGTCCTAAAAAGACATGGAAAAGAGCTTATAAACTTTAGCAAA
                  ************************************************************

HsCD00081233      AGGAGGAAAGTAGCAGAAATAACAGGAGAGATCCAGCAGTACCAAAATCAGCCTTACTGT
NM_005633.3       AGGAGGAAAGTAGCAGAAATAACAGGAGAGATCCAGCAGTACCAAAATCAGCCTTACTGT
                  ************************************************************

HsCD00081233      TTACGAGTAGAATCAGATATCAAAAGGTTCTTTGAAAACTTGAATCCGATGGGAAATAGC
NM_005633.3       TTACGAGTAGAATCAGATATCAAAAGGTTCTTTGAAAACTTGAATCCGATGGGAAATAGC
                  ************************************************************

HsCD00081233      ATGGAGAAGGAATTTACAGATTATCTTTTCAACAAATCCCTAGAAATAGAACCACGAAAC
NM_005633.3       ATGGAGAAGGAATTTACAGATTATCTTTTCAACAAATCCCTAGAAATAGAACCACGAAAC
                  ************************************************************

HsCD00081233      CCTAAGCCTCTCCCAAGATTTCCAAAAAAATATAGCTATCCCCTAAAATCTCCTGGTGTT
NM_005633.3       CCTAAGCCTCTCCCAAGATTTCCAAAAAAATATAGCTATCCCCTAAAATCTCCTGGTGTT
                  ************************************************************

HsCD00081233      CGTCCATCAAACCCAAGACCAGGTACCATGAGGCATCCCACACCTCTGCAGCAGGAGCCA
NM_005633.3       CGTCCATCAAACCCAAGACCAGGTACCATGAGGCATCCCACACCTCTGCAGCAGGAGCCA
                  ************************************************************

HsCD00081233      AGGAAAATTAGTTATAGTAGGATCCCTGAAAGTGAAACAGAAAGTACAGCATCTGCACCA
NM_005633.3       AGGAAAATTAGTTATAGTAGGATCCCTGAAAGTGAAACAGAAAGTACAGCATCTGCACCA
                  ************************************************************

HsCD00081233      AATTCTCCAAGAACACCGTTAACACCTCCGCCTGCTTCTGGTGCTTCCAGTACCACAGAT
NM_005633.3       AATTCTCCAAGAACACCGTTAACACCTCCGCCTGCTTCTGGTGCTTCCAGTACCACAGAT
                  ************************************************************

HsCD00081233      GTTTGCAGTGTATTTGATTCCGATCATTCGAGCCCTTTTCACTCAAGCAATGATACCGTC
NM_005633.3       GTTTGCAGTGTATTTGATTCCGATCATTCGAGCCCTTTTCACTCAAGCAATGATACCGTC
                  ************************************************************

HsCD00081233      TTTATCCAAGTTACTCTGCCCCATGGCCCAAGATCTGCTTCTGTATCATCTATAAGTTTA
NM_005633.3       TTTATCCAAGTTACTCTGCCCCATGGCCCAAGATCTGCTTCTGTATCATCTATAAGTTTA
                  ************************************************************

HsCD00081233      ACCAAAGGCACTGATGAAGTGCCTGTCCCTCCTCCTGTTCCTCCACGAAGACGACCAGAA
NM_005633.3       ACCAAAGGCACTGATGAAGTGCCTGTCCCTCCTCCTGTTCCTCCACGAAGACGACCAGAA
                  ************************************************************

HsCD00081233      TCTGCCCCAGCAGAATCTTCACCATCTAAGATTATGTCTAAGCATTTGGACAGTCCCCCA
NM_005633.3       TCTGCCCCAGCAGAATCTTCACCATCTAAGATTATGTCTAAGCATTTGGACAGTCCCCCA
                  ************************************************************

HsCD00081233      GCCATTCCTCCTAGGCAACCCACATCAAAAGCCTATTCACCACGATATTCAATATCAGAC
NM_005633.3       GCCATTCCTCCTAGGCAACCCACATCAAAAGCCTATTCACCACGATATTCAATATCAGAC
                  ************************************************************

HsCD00081233      CGGACCTCTATCTCAGACCCTCCTGAAAGCCCTCCCTTATTACCACCACGAGAACCTGTG
NM_005633.3       CGGACCTCTATCTCAGACCCTCCTGAAAGCCCTCCCTTATTACCACCACGAGAACCTGTG
                  ************************************************************

HsCD00081233      AGGACACCTGATGTTTTCTCAAGCTCACCACTACATCTCCAACCTCCCCCTTTGGGCAAA
NM_005633.3       AGGACACCTGATGTTTTCTCAAGCTCACCACTACATCTCCAACCTCCCCCTTTGGGCAAA
                  ************************************************************

HsCD00081233      AAAAGTGACCATGGCAATGCCTTCTTCCCAAACAGCCCTTCCCCCTTTACACCACCTCCT
NM_005633.3       AAAAGTGACCATGGCAATGCCTTCTTCCCAAACAGCCCTTCCCCCTTTACACCACCTCCT
                  ************************************************************

HsCD00081233      CCTCAAACACCTTCTCCTCACGGCACAAGAAGGCATCTGCCATCACCACCATTGACACAA
NM_005633.3       CCTCAAACACCTTCTCCTCACGGCACAAGAAGGCATCTGCCATCACCACCATTGACACAA
                  ************************************************************

HsCD00081233      GAAGTGGACCTTCATTCCATTGCTGGGCCGCCTGTTCCTCCACGACAAAGCACTTCTCAA
NM_005633.3       GAAGTGGACCTTCATTCCATTGCTGGGCCGCCTGTTCCTCCACGACAAAGCACTTCTCAA
                  ************************************************************

HsCD00081233      CATATCCCTAAACTCCCTCCAAAAACTTACAAAAGGGAGCACACACACCCATCCATGCAC
NM_005633.3       CATATCCCTAAACTCCCTCCAAAAACTTACAAAAGGGAGCACACACACCCATCCATGCAC
                  ************************************************************

HsCD00081233      AGAGATGGACCACCACTGTTGGAGAATGCCCATTCTTCC---
NM_005633.3       AGAGATGGACCACCACTGTTGGAGAATGCCCATTCTTCCTGA
                  ***************************************   

Pathways

NCI : BCR signaling pathway
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EGFR-dependent Endothelin signaling events
NCI : EPO signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IGF1 pathway
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Insulin Pathway
NCI : Internalization of ErbB1
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Regulation of RAC1 activity
NCI : Regulation of Ras family activation
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : TGF-beta receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR3 signaling in lymphatic endothelium
Panther : Angiogenesis
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Reactome : Activation of Rac
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Axon guidance
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cell surface interactions at the vascular wall
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : FCERI mediated Ca+2 mobilization
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : GRB2:SOS provides linkage to MAPK signaling for Integrins
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NRAGE signals death through JNK
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Rho GTPase cycle
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signal attenuation
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by Rho GTPases
Reactome : Signaling by Robo receptor
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Tie2 Signaling
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 265857
HIP Master Clone ID : 197955
IMAGE ID : 100014292
Original Clone ID : FLH265857.01L

Organism


TAX_ID : 9606
Species Specific ID: 6654

Genome

Chromosome : 2
Map Location : 2p21
Ensembl : ENSG00000115904

Reagents

Labome : Sos-antibody