DNASU Plasmid Repository • 480.965.5697 | Email

HTR3B (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HTR3B
Gene Name:  5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
Sequence             
Original Clone ID: FLH265919.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00081295

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1323nts         Open reading frame : 1 to 1323
Reference Sequence Alignment

ATGTTGTCAAGTGTAATGGCTCCCCTGTGGGCCTGCATCCTGGTGGCTGCAGGAATTCTA
GCCACAGATACACATCATCCCCAGGATTCTGCTCTGTATCATCTCAGCAAGCAGCTATTA
CAGAAATATCATAAAGAAGTGAGACCTGTTTACAACTGGACCAAGGCCACCACAGTCTAC
CTGGACCTGTTCGTCCATGCTATATTGGATGTGGATGCAGAGAATCAAATATTAAAGACA
AGTGTATGGTACCAAGAGGTCTGGAATGATGAATTTTTATCCTGGAACTCCAGCATGTTT
GATGAGATTAGAGAGATCTCCCTACCTCTAAGTGCCATCTGGGCCCCCGATATCATCATC
AATGAGTTTGTGGACATTGAAAGATACCCTGACCTTCCCTATGTTTATGTGAACTCATCT
GGGACCATTGAGAACTATAAGCCCATCCAGGTGGTCTCTGCGTGCAGTTTAGAGACATAT
GCTTTTCCATTTGATGTCCAGAATTGCAGCCTGACCTTCAAGAGCATTCTGCATACAGTG
GAAGACGTAGACCTGGCCTTTCTGAGGAGCCCAGAAGACATTCAGCATGACAAAAAGGCG
TTTTTGAATGACAGTGAGTGGGAACTTCTATCTGTGTCCTCCACATACAGCATCCTGCAG
AGCAGCGCTGGAGGATTTGCACAGATTCAGTTTAATGTGGTGATGCGCAGGCACCCCCTG
GTCTATGTCGTGAGTCTGCTGATTCCTAGCATCTTTCTCATGCTGGTGGACCTGGGGAGC
TTCTACCTGCCACCCAACTGCCGAGCCAGGATTGTGTTCAAGACCAGTGTGCTGGTGGGC
TACACCGTCTTCAGGGTCAACATGTCCAACCAGGTGCCACGGAGTGTAGGGAGCACCCCT
CTGATTGGGCACTTCTTCACCATCTGCATGGCCTTCTTGGTTCTCAGCTTAGCTAAGTCC
ATCGTGTTGGTCAAATTCCTCCATGATGAGCAGCGTGGTGGACAGGAGCAGCCCTTCTTG
TGCCTTCGAGGGGACACCGATGCTGACAGGCCTAGAGTGGAACCCAGGGCCCAACGTGCT
GTGGTAACAGAGTCCTCGCTGTATGGAGAGCACCTGGCCCAGCCAGGAACCCTGAAGGAA
GTCTGGTCGCAGCTTCAATCTATCAGCAACTACCTCCAAACTCAGGACCAGACAGACCAA
CAGGAGGCAGAGTGGCTGGTCCTCCTGTCCCGCTTTGACCGACTGCTCTTCCAAAGCTAC
CTTTTCATGCTGGGGATCTACACCATCACTCTGTGCTCCCTCTGGGCACTGTGGGGCGGC
GTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1393
Start on reference sequence 68
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HTR3B
Symbol Nomenclature : HTR3B
SYNONYM : 5-HT3B
Designation : 5-HT3-B|5-hydroxytryptamine 3 receptor B subunit|5-hydroxytryptamine receptor 3B|serotonin-gated ion channel subunit
Full Nomenclature : 5-hydroxytryptamine (serotonin) receptor 3B, ionotropic
GENEID : 9177
GI : 146327187
GenBank Accession : BC141515
HGNC : 5298
MIM : 604654
Vega : OTTHUMG00000168210
Target GenBank: NM_006028

 

Reference Sequence Alignment

  

HsCD00081295      ATGTTGTCAAGTGTAATGGCTCCCCTGTGGGCCTGCATCCTGGTGGCTGCAGGAATTCTA
NM_006028.4       ATGTTGTCAAGTGTAATGGCTCCCCTGTGGGCCTGCATCCTGGTGGCTGCAGGAATTCTA
                  ************************************************************

HsCD00081295      GCCACAGATACACATCATCCCCAGGATTCTGCTCTGTATCATCTCAGCAAGCAGCTATTA
NM_006028.4       GCCACAGATACACATCATCCCCAGGATTCTGCTCTGTATCATCTCAGCAAGCAGCTATTA
                  ************************************************************

HsCD00081295      CAGAAATATCATAAAGAAGTGAGACCTGTTTACAACTGGACCAAGGCCACCACAGTCTAC
NM_006028.4       CAGAAATATCATAAAGAAGTGAGACCTGTTTACAACTGGACCAAGGCCACCACAGTCTAC
                  ************************************************************

HsCD00081295      CTGGACCTGTTCGTCCATGCTATATTGGATGTGGATGCAGAGAATCAAATATTAAAGACA
NM_006028.4       CTGGACCTGTTCGTCCATGCTATATTGGATGTGGATGCAGAGAATCAAATATTAAAGACA
                  ************************************************************

HsCD00081295      AGTGTATGGTACCAAGAGGTCTGGAATGATGAATTTTTATCCTGGAACTCCAGCATGTTT
NM_006028.4       AGTGTATGGTACCAAGAGGTCTGGAATGATGAATTTTTATCCTGGAACTCCAGCATGTTT
                  ************************************************************

HsCD00081295      GATGAGATTAGAGAGATCTCCCTACCTCTAAGTGCCATCTGGGCCCCCGATATCATCATC
NM_006028.4       GATGAGATTAGAGAGATCTCCCTACCTCTAAGTGCCATCTGGGCCCCCGATATCATCATC
                  ************************************************************

HsCD00081295      AATGAGTTTGTGGACATTGAAAGATACCCTGACCTTCCCTATGTTTATGTGAACTCATCT
NM_006028.4       AATGAGTTTGTGGACATTGAAAGATACCCTGACCTTCCCTATGTTTATGTGAACTCATCT
                  ************************************************************

HsCD00081295      GGGACCATTGAGAACTATAAGCCCATCCAGGTGGTCTCTGCGTGCAGTTTAGAGACATAT
NM_006028.4       GGGACCATTGAGAACTATAAGCCCATCCAGGTGGTCTCTGCGTGCAGTTTAGAGACATAT
                  ************************************************************

HsCD00081295      GCTTTTCCATTTGATGTCCAGAATTGCAGCCTGACCTTCAAGAGCATTCTGCATACAGTG
NM_006028.4       GCTTTTCCATTTGATGTCCAGAATTGCAGCCTGACCTTCAAGAGCATTCTGCATACAGTG
                  ************************************************************

HsCD00081295      GAAGACGTAGACCTGGCCTTTCTGAGGAGCCCAGAAGACATTCAGCATGACAAAAAGGCG
NM_006028.4       GAAGACGTAGACCTGGCCTTTCTGAGGAGCCCAGAAGACATTCAGCATGACAAAAAGGCG
                  ************************************************************

HsCD00081295      TTTTTGAATGACAGTGAGTGGGAACTTCTATCTGTGTCCTCCACATACAGCATCCTGCAG
NM_006028.4       TTTTTGAATGACAGTGAGTGGGAACTTCTATCTGTGTCCTCCACATACAGCATCCTGCAG
                  ************************************************************

HsCD00081295      AGCAGCGCTGGAGGATTTGCACAGATTCAGTTTAATGTGGTGATGCGCAGGCACCCCCTG
NM_006028.4       AGCAGCGCTGGAGGATTTGCACAGATTCAGTTTAATGTGGTGATGCGCAGGCACCCCCTG
                  ************************************************************

HsCD00081295      GTCTATGTCGTGAGTCTGCTGATTCCTAGCATCTTTCTCATGCTGGTGGACCTGGGGAGC
NM_006028.4       GTCTATGTCGTGAGTCTGCTGATTCCTAGCATCTTTCTCATGCTGGTGGACCTGGGGAGC
                  ************************************************************

HsCD00081295      TTCTACCTGCCACCCAACTGCCGAGCCAGGATTGTGTTCAAGACCAGTGTGCTGGTGGGC
NM_006028.4       TTCTACCTGCCACCCAACTGCCGAGCCAGGATTGTGTTCAAGACCAGTGTGCTGGTGGGC
                  ************************************************************

HsCD00081295      TACACCGTCTTCAGGGTCAACATGTCCAACCAGGTGCCACGGAGTGTAGGGAGCACCCCT
NM_006028.4       TACACCGTCTTCAGGGTCAACATGTCCAACCAGGTGCCACGGAGTGTAGGGAGCACCCCT
                  ************************************************************

HsCD00081295      CTGATTGGGCACTTCTTCACCATCTGCATGGCCTTCTTGGTTCTCAGCTTAGCTAAGTCC
NM_006028.4       CTGATTGGGCACTTCTTCACCATCTGCATGGCCTTCTTGGTTCTCAGCTTAGCTAAGTCC
                  ************************************************************

HsCD00081295      ATCGTGTTGGTCAAATTCCTCCATGATGAGCAGCGTGGTGGACAGGAGCAGCCCTTCTTG
NM_006028.4       ATCGTGTTGGTCAAATTCCTCCATGATGAGCAGCGTGGTGGACAGGAGCAGCCCTTCTTG
                  ************************************************************

HsCD00081295      TGCCTTCGAGGGGACACCGATGCTGACAGGCCTAGAGTGGAACCCAGGGCCCAACGTGCT
NM_006028.4       TGCCTTCGAGGGGACACCGATGCTGACAGGCCTAGAGTGGAACCCAGGGCCCAACGTGCT
                  ************************************************************

HsCD00081295      GTGGTAACAGAGTCCTCGCTGTATGGAGAGCACCTGGCCCAGCCAGGAACCCTGAAGGAA
NM_006028.4       GTGGTAACAGAGTCCTCGCTGTATGGAGAGCACCTGGCCCAGCCAGGAACCCTGAAGGAA
                  ************************************************************

HsCD00081295      GTCTGGTCGCAGCTTCAATCTATCAGCAACTACCTCCAAACTCAGGACCAGACAGACCAA
NM_006028.4       GTCTGGTCGCAGCTTCAATCTATCAGCAACTACCTCCAAACTCAGGACCAGACAGACCAA
                  ************************************************************

HsCD00081295      CAGGAGGCAGAGTGGCTGGTCCTCCTGTCCCGCTTTGACCGACTGCTCTTCCAAAGCTAC
NM_006028.4       CAGGAGGCAGAGTGGCTGGTCCTCCTGTCCCGCTTTGACCGACTGCTCTTCCAAAGCTAC
                  ************************************************************

HsCD00081295      CTTTTCATGCTGGGGATCTACACCATCACTCTGTGCTCCCTCTGGGCACTGTGGGGCGGC
NM_006028.4       CTTTTCATGCTGGGGATCTACACCATCACTCTGTGCTCCCTCTGGGCACTGTGGGGCGGC
                  ************************************************************

HsCD00081295      GTG---
NM_006028.4       GTGTGA
                  ***   

Pathways

Panther : 5HT3 type receptor mediated signaling pathway
Reactome : Ion channel transport
Reactome : Ligand-gated ion channel transport
Reactome : Transmembrane transport of small molecules

Protein

UniProt : O95264
HPRD : 06875

Clone

Cloning Information : 265919
HIP Master Clone ID : 198017
IMAGE ID : 100014568
Original Clone ID : FLH265919.01L

Organism


TAX_ID : 9606
Species Specific ID: 9177

Genome

Chromosome : 11
Map Location : 11q23.1
Ensembl : ENSG00000149305

Reagents

Labome : HTR3B-antibody