DNASU Plasmid Repository • 480.965.5697 | Email

DNAJA5 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DNAJC21
Gene Name:  DnaJ (Hsp40) homolog, subfamily C, member 21
Sequence             
Original Clone ID: FLH265921.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00081297

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1728nts         Open reading frame : 1 to 1728
Reference Sequence Alignment

ATGAAGTGTCACTATGAGGCGCTGGGGGTGCGGCGCGACGCCAGCGAGGAGGAGCTCAAG
AAGGCCTATCGGAAGCTGGCCCTGAAATGGCACCCGGATAAAAATCTGGATAATGCCGCA
GAAGCAGCTGAACAATTTAAATTAATCCAAGCAGCATATGATGTGTTGAGTGACCCTCAG
GAAAGAGCATGGTATGATAATCATAGAGAGGCCCTACTTAAAGGTGGGTTTGATGGCGAA
TATCAAGATGACAGCTTAGATTTGCTACGCTATTTCACCGTTACCTGTTATTCTGGTTAT
GGAGATGATGAAAAGGGATTTTACACGGTGTATCGTAATGTTTTTGAAATGATTGCCAAG
GAAGAACTAGAATCTGTGTTAGAGGAAGAGGTTGATGATTTCCCAACTTTTGGAGACTCC
CAGAGTGACTATGATACGGTAGTCCATCCTTTCTACGCTTATTGGCAGAGTTTCTGCACT
CAAAAGAATTTTGCATGGAAGGAAGAATATGATACACGACAGGCTTCAAACCGCTGGGAA
AAACGAGCCATGGAAAAAGAAAACAAAAAGATTCGGGACAAAGCAAGGAAAGAGAAGAAT
GAGCTTGTCCGTCAGCTGGTAGCTTTCATTCGTAAAAGAGATAAAAGAGTGCAGGCGCAT
CGAAAACTTGTGGAAGAACAGAATGCAGAGAAGGCGAGGAAAGCCGAAGAGATGAGGCGG
CAGCAGAAGCTAAAGCAGGCCAAACTGGTGGAGCAGTACAGAGAACAGAGCTGGATGACT
ATGGCCAATTTGGAGAAAGAGCTCCAGGAGATGGAGGCACGGTACGAGAAGGAGTTTGGA
GATGGATCGGATGAAAATGAAATGGAAGAACATGAACTCAAAGATGAGGAGGATGGTAAA
GACAGTGATGAGGCCGAGGACGCTGAGCTCTATGATGACCTTTACTGCCCAGCATGTGAC
AAATCGTTCAAGACAGAAAAGGCCATGAAGAATCACGAGAAGTCAAAGAAGCATCGGGAA
ATGGTGGCCTTGCTAAAACAACAGCTGGAGGAGGAAGAAGAAAATTTTTCAAGACCTCAA
ATTGATGAAAATCCATTAGATGACAATTCTGAGGAAGAAATGGAAGATGCACCAAAACAA
AAGCTTTCTAAAAAACAGAAGAAAAAGAAACAGAAACCAGCACAGGATGTACCTGGCAAA
GATTCATATCTGCCTGCAGCTCACTTTCAGATGGCTTGGGGAAAAAAGTGTGTGTTGGGA
GAGAGAAGAGATGGAGAGAGCGAGCACAAATGTGCCAAAATGTTGCTTGAAAACAGACAG
AATTATGATGACAATTTCAATGTAAATGGACCTGGAGAAGGAGTAAAGGTTGATCCAGAA
GATACTAACTTAAATCAAGACAGTGCCAAAGAATTGGAAGATAGTCCCCAGGAAAATGTC
AGTGTCACAGAGATCATTAAACCATGTGATGATCCAAAAAGTGAAGCTAAAAGTGTTCCT
AAACCCAAAGGAAAGAAAACCAAAGATATGAAAAAACCTGTCAGAGTACCTGCTGAACCA
CAAACAATGAGTGTTCTTATCAGCTGTACAACCTGCCATAGTGAATTTCCATCTCGGAAT
AAACTTTTTGACCATCTAAAGGCCACAGGTCATGCAAGAGCACCTTCATCATCGTCTTTA
AACAGCGCAACAAGTAGTCAAAGCAAGAAAGAGAAACGTAAAAACAGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1958
Start on reference sequence 228
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DNAJC21
Symbol Nomenclature : DNAJC21
SYNONYM : DNAJA5; GS3; JJJ1
Designation : DnaJ homology subfamily A member 5|JJJ1 DnaJ domain protein homolog|dnaJ homolog subfamily A member 5|dnaJ homolog subfamily C member 21
Full Nomenclature : DnaJ (Hsp40) homolog, subfamily C, member 21
GENEID : 134218
GI : 146327189
GenBank Accession : BC141523
HGNC : 27030
Vega : OTTHUMG00000074103
Target GenBank: NM_194283

 

Reference Sequence Alignment

  

HsCD00081297        ATGAAGTGTCACTATGAGGCGCTGGGGGTGCGGCGCGACGCCAGCGAGGAGGAGCTCAAG
NM_194283.3         ATGAAGTGTCACTATGAGGCGCTGGGGGTGCGGCGCGACGCCAGCGAGGAGGAGCTCAAG
NM_001012339.2      ATGAAGTGTCACTATGAGGCGCTGGGGGTGCGGCGCGACGCCAGCGAGGAGGAGCTCAAG
                    ************************************************************

HsCD00081297        AAGGCCTATCGGAAGCTGGCCCTGAAATGGCACCCGGATAAAAATCTGGATAATGCCGCA
NM_194283.3         AAGGCCTATCGGAAGCTGGCCCTGAAATGGCACCCGGATAAAAATCTGGATAATGCCGCA
NM_001012339.2      AAGGCCTATCGGAAGCTGGCCCTGAAATGGCACCCGGATAAAAATCTGGATAATGCCGCA
                    ************************************************************

HsCD00081297        GAAGCAGCTGAACAATTTAAATTAATCCAAGCAGCATATGATGTGTTGAGTGACCCTCAG
NM_194283.3         GAAGCAGCTGAACAATTTAAATTAATCCAAGCAGCATATGATGTGTTGAGTGACCCTCAG
NM_001012339.2      GAAGCAGCTGAACAATTTAAATTAATCCAAGCAGCATATGATGTGTTGAGTGACCCTCAG
                    ************************************************************

HsCD00081297        GAAAGAGCATGGTATGATAATCATAGAGAGGCCCTACTTAAAGGTGGGTTTGATGGCGAA
NM_194283.3         GAAAGAGCATGGTATGATAATCATAGAGAGGCCCTACTTAAAGGTGGGTTTGATGGCGAA
NM_001012339.2      GAAAGAGCATGGTATGATAATCATAGAGAGGCCCTACTTAAAGGTGGGTTTGATGGCGAA
                    ************************************************************

HsCD00081297        TATCAAGATGACAGCTTAGATTTGCTACGCTATTTCACCGTTACCTGTTATTCTGGTTAT
NM_194283.3         TATCAAGATGACAGCTTAGATTTGCTACGCTATTTCACCGTTACCTGTTATTCTGGTTAT
NM_001012339.2      TATCAAGATGACAGCTTAGATTTGCTACGCTATTTCACCGTTACCTGTTATTCTGGTTAT
                    ************************************************************

HsCD00081297        GGAGATGATGAAAAGGGATTTTACACGGTGTATCGTAATGTTTTTGAAATGATTGCCAAG
NM_194283.3         GGAGATGATGAAAAGGGATTTTACACGGTGTATCGTAATGTTTTTGAAATGATTGCCAAG
NM_001012339.2      GGAGATGATGAAAAGGGATTTTACACGGTGTATCGTAATGTTTTTGAAATGATTGCCAAG
                    ************************************************************

HsCD00081297        GAAGAACTAGAATCTGTGTTAGAGGAAGAGGTTGATGATTTCCCAACTTTTGGAGACTCC
NM_194283.3         GAAGAACTAGAATCTGTGTTAGAGGAAGAGGTTGATGATTTCCCAACTTTTGGAGACTCC
NM_001012339.2      GAAGAACTAGAATCTGTGTTAGAGGAAGAGGTTGATGATTTCCCAACTTTTGGAGACTCC
                    ************************************************************

HsCD00081297        CAGAGTGACTATGATACGGTAGTCCATCCTTTCTACGCTTATTGGCAGAGTTTCTGCACT
NM_194283.3         CAGAGTGACTATGATACGGTAGTCCATCCTTTCTACGCTTATTGGCAGAGTTTCTGCACT
NM_001012339.2      CAGAGTGACTATGATACGGTAGTCCATCCTTTCTACGCTTATTGGCAGAGTTTCTGCACT
                    ************************************************************

HsCD00081297        CAAAAGAATTTTGCATGGAAGGAAGAATATGATACACGACAGGCTTCAAACCGCTGGGAA
NM_194283.3         CAAAAGAATTTTGCATGGAAGGAAGAATATGATACACGACAGGCTTCAAACCGCTGGGAA
NM_001012339.2      CAAAAGAATTTTGCATGGAAGGAAGAATATGATACACGACAGGCTTCAAACCGCTGGGAA
                    ************************************************************

HsCD00081297        AAACGAGCCATGGAAAAAGAAAACAAAAAGATTCGGGACAAAGCAAGGAAAGAGAAGAAT
NM_194283.3         AAACGAGCCATGGAAAAAGAAAACAAAAAGATTCGGGACAAAGCAAGGAAAGAGAAGAAT
NM_001012339.2      AAACGAGCCATGGAAAAAGAAAACAAAAAGATTCGGGACAAAGCAAGGAAAGAGAAGAAT
                    ************************************************************

HsCD00081297        GAGCTTGTCCGTCAGCTGGTAGCTTTCATTCGTAAAAGAGATAAAAGAGTGCAGGCGCAT
NM_194283.3         GAGCTTGTCCGTCAGCTGGTAGCTTTCATTCGTAAAAGAGATAAAAGAGTGCAGGCGCAT
NM_001012339.2      GAGCTTGTCCGTCAGCTGGTAGCTTTCATTCGTAAAAGAGATAAAAGAGTGCAGGCGCAT
                    ************************************************************

HsCD00081297        CGAAAACTTGTGGAAGAACAGAATGCAGAGAAGGCGAGGAAAGCCGAAGAGATGAGGCGG
NM_194283.3         CGAAAACTTGTGGAAGAACAGAATGCAGAGAAGGCGAGGAAAGCCGAAGAGATGAGGCGG
NM_001012339.2      CGAAAACTTGTGGAAGAACAGAATGCAGAGAAGGCGAGGAAAGCCGAAGAGATGAGGCGG
                    ************************************************************

HsCD00081297        CAGCAGAAGCTAAAGCAGGCCAAACTGGTGGAGCAGTACAGAGAACAGAGCTGGATGACT
NM_194283.3         CAGCAGAAGCTAAAGCAGGCCAAACTGGTGGAGCAGTACAGAGAACAGAGCTGGATGACT
NM_001012339.2      CAGCAGAAGCTAAAGCAGGCCAAACTGGTGGAGCAGTACAGAGAACAGAGCTGGATGACT
                    ************************************************************

HsCD00081297        ATGGCCAATTTGGAGAAAGAGCTCCAGGAGATGGAGGCACGGTACGAGAAGGAGTTTGGA
NM_194283.3         ATGGCCAATTTGGAGAAAGAGCTCCAGGAGATGGAGGCACGGTACGAGAAGGAGTTTGGA
NM_001012339.2      ATGGCCAATTTGGAGAAAGAGCTCCAGGAGATGGAGGCACGGTACGAGAAGGAGTTTGGA
                    ************************************************************

HsCD00081297        GATGGATCGGATGAAAATGAAATGGAAGAACATGAACTCAAAGATGAGGAGGATGGTAAA
NM_194283.3         GATGGATCGGATGAAAATGAAATGGAAGAACATGAACTCAAAGATGAGGAGGATGGTAAA
NM_001012339.2      GATGGATCGGATGAAAATGAAATGGAAGAACATGAACTCAAAGATGAGGAGGATGGTAAA
                    ************************************************************

HsCD00081297        GACAGTGATGAGGCCGAGGACGCTGAGCTCTATGATGACCTTTACTGCCCAGCATGTGAC
NM_194283.3         GACAGTGATGAGGCCGAGGACGCTGAGCTCTATGATGACCTTTACTGCCCAGCATGTGAC
NM_001012339.2      GACAGTGATGAGGCCGAGGACGCTGAGCTCTATGATGACCTTTACTGCCCAGCATGTGAC
                    ************************************************************

HsCD00081297        AAATCGTTCAAGACAGAAAAGGCCATGAAGAATCACGAGAAGTCAAAGAAGCATCGGGAA
NM_194283.3         AAATCGTTCAAGACAGAAAAGGCCATGAAGAATCACGAGAAGTCAAAGAAGCATCGGGAA
NM_001012339.2      AAATCGTTCAAGACAGAAAAGGCCATGAAGAATCACGAGAAGTCAAAGAAGCATCGGGAA
                    ************************************************************

HsCD00081297        ATGGTGGCCTTGCTAAAACAACAGCTGGAGGAGGAAGAAGAAAATTTTTCAAGACCTCAA
NM_194283.3         ATGGTGGCCTTGCTAAAACAACAGCTGGAGGAGGAAGAAGAAAATTTTTCAAGACCTCAA
NM_001012339.2      ATGGTGGCCTTGCTAAAACAACAGCTGGAGGAGGAAGAAGAAAATTTTTCAAGACCTCAA
                    ************************************************************

HsCD00081297        ATTGATGAAAATCCATTAGATGACAATTCTGAGGAAGAAATGGAAGATGCACCAAAACAA
NM_194283.3         ATTGATGAAAATCCATTAGATGACAATTCTGAGGAAGAAATGGAAGATGCACCAAAACAA
NM_001012339.2      ATTGATGAAAATCCATTAGATGACAATTCTGAGGAAGAAATGGAAGATGCACCAAAACAA
                    ************************************************************

HsCD00081297        AAGCTTTCTAAAAAACAGAAGAAAAAGAAACAGAAACCAGCACAGGATGTACCTGGCAAA
NM_194283.3         AAGCTTTCTAAAAAACAGAAGAAAAAGAAACAGAAACCAGCACAGGATGTACCTGGCAAA
NM_001012339.2      AAGCTTTCTAAAAAACAGAAGAAAAAGAAACAGAAACCAGCACAG---------------
                    *********************************************               

HsCD00081297        GATTCATATCTGCCTGCAGCTCACTTTCAGATGGCTTGGGGAAAAAAGTGTGTGTTGGGA
NM_194283.3         GATTCATATCTGCCTGCAGCTCACTTTCAGATGGCTTGGGGAAAAAAGTGTGTGTTGGGA
NM_001012339.2      ------------------------------------------------------------
                                                                                

HsCD00081297        GAGAGAAGAGATGGAGAGAGCGAGCACAAATGTGCCAAAATGTTGCTTGAAAACAGACAG
NM_194283.3         GAGAGAAGAGATGGAGAGAGCGAGCACAAATGTGCCAAAATGTTGCTTGAAAACAGACAG
NM_001012339.2      ------------------------------------------------------------
                                                                                

HsCD00081297        AATTATGATGACAATTTCAATGTAAATGGACCTGGAGAAGGAGTAAAGGTTGATCCAGAA
NM_194283.3         AATTATGATGACAATTTCAATGTAAATGGACCTGGAGAAGGAGTAAAGGTTGATCCAGAA
NM_001012339.2      AATTATGATGACAATTTCAATGTAAATGGACCTGGAGAAGGAGTAAAGGTTGATCCAGAA
                    ************************************************************

HsCD00081297        GATACTAACTTAAATCAAGACAGTGCCAAAGAATTGGAAGATAGTCCCCAGGAAAATGTC
NM_194283.3         GATACTAACTTAAATCAAGACAGTGCCAAAGAATTGGAAGATAGTCCCCAGGAAAATGTC
NM_001012339.2      GATACTAACTTAAATCAAGACAGTGCCAAAGAATTGGAAGATAGTCCCCAGGAAAATGTC
                    ************************************************************

HsCD00081297        AGTGTCACAGAGATCATTAAACCATGTGATGATCCAAAAAGTGAAGCTAAAAGTGTTCCT
NM_194283.3         AGTGTCACAGAGATCATTAAACCATGTGATGATCCAAAAAGTGAAGCTAAAAGTGTTCCT
NM_001012339.2      AGTGTCACAGAGATCATTAAACCATGTGATGATCCAAAAAGTGAAGCTAAAAGTGTTCCT
                    ************************************************************

HsCD00081297        AAACCCAAAGGAAAGAAAACCAAAGATATGAAAAAACCTGTCAGAGTACCTGCTGAACCA
NM_194283.3         AAACCCAAAGGAAAGAAAACCAAAGATATGAAAAAACCTGTCAGAGTACCTGCTGAACCA
NM_001012339.2      AAACCCAAAGGAAAGAAAACCAAAGATATGAAAAAACCTGTCAGAGTACCTGCTGAACCA
                    ************************************************************

HsCD00081297        CAAACAATGAGTGTTCTTATCAGCTGTACAACCTGCCATAGTGAATTTCCATCTCGGAAT
NM_194283.3         CAAACAATGAGTGTTCTTATCAGCTGTACAACCTGCCATAGTGAATTTCCATCTCGGAAT
NM_001012339.2      CAAACAATGAGTGTTCTTATCAGCTGTACAACCTGCCATAGTGAATTTCCATCTCGGAAT
                    ************************************************************

HsCD00081297        AAACTTTTTGACCATCTAAAGGCCACAGGTCATGCAAGAGCACCTTCATCATCGTCTTTA
NM_194283.3         AAACTTTTTGACCATCTAAAGGCCACAGGTCATGCAAGAGCACCTTCATCATCGTCTTTA
NM_001012339.2      AAACTTTTTGACCATCTAAAGGCCACAGGTCATGCAAGAGCACCTTCATCATCGTCTTTA
                    ************************************************************

HsCD00081297        AACAGCGCAACAAGTAGTCAAAGCAAGAAAGAGAAACGTAAAAACAGA---
NM_194283.3         AACAGCGCAACAAGTAGTCAAAGCAAGAAAGAGAAACGTAAAAACAGATAG
NM_001012339.2      AACAGCGCAACAAGTAGTCAAAGCAAGAAAGAGAAACGTAAAAACAGATAG
                    ************************************************   

Clone

Cloning Information : 265921
HIP Master Clone ID : 198019
IMAGE ID : 100014581
Original Clone ID : FLH265921.01L

Organism


TAX_ID : 9606
Species Specific ID: 134218

Genome

Chromosome : 5
Map Location : 5p13.2
Ensembl : ENSG00000168724

Reagents

Labome : DNAJC21-antibody