DNASU Plasmid Repository • 480.965.5697 | Email

DKFZp762I137 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ZNF786
Gene Name:  zinc finger protein 786
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH266072.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
HsCD00081448

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2346nts         Open reading frame : 1 to 2346
Reference Sequence Alignment

ATGGCGGAGCCGCCTCGGCTACCTCTGACTTTTGAGGATGTTGCTATTTATTTCTCCGAG
CAAGAATGGCAGGATCTAGAGGCATGGCAGAAGGAACTTTACAAGCATGTGATGAGAAGC
AATTATGAGACTCTCGTCTCTCTAGATGATGGACTTCCAAAACCAGAACTAATATCCTGG
ATTGAACACGGGGGAGAGCCCTTCAGGAAATGGAGAGAATCACAGAAATCAGGAAACATA
ATTTGCTCCTCTGTTGATATGCATTTTGATCCAGGTTTTGAGGAACAGCTGTTTTGGGGA
AGCCAGCAGGCTATGAATTCAGGAAAAACTAAAAGCCATTTCCAATTAGATCCTGAAAGC
CAGTGTTCCTTTGGATCCTTTGTTTCCTTCAGGCCTGACCAAGGCATCACCCTCGGGAGC
CCACAGAGACACGACGCCAGGGCTCCTCCACCACTAGCCTGCGGCCCCAGTGAATCTACC
CTAAAAGAAGGAATCCCAGGTCCCAGAAATCTGGATCTTCCTGGTTTGTGGGACGTCCCC
GCCTGGGAGAGCACCCAGCACCCTTGGCCTGTCTGCGGGGAAAGCTGTTGGGAGAACAAC
CATTTAGTAATGCACCAGAGAGGCCACTCAAAGGACCGGACACGTAGGGCCTGGGAGAAA
TTCAACAAGAGGGCGGAGACGCAGATGCCGTGGAGCAGCCCTCGGGTACAGAGGCACTTC
CGGTGTGGCGTGTGCGGTAAGAGCTTCCGCCGGAAGCTGTGTCTGCTGCGCCATCTGGCG
GCCCACACGGGGAGGGGCCCCTTCCGGAACGCTGACGGTGAAATGTGCTTCCGACACGAG
CTGACCCATCCCAGCCACCGCCTCCCGCAGCAGGGGGAGAAGCCTGCCCAGTGCACCCCA
TGCGGCAAGCGCTCCCTCCCAGTGGACAGCACGCAGGCTCGCCGGTGCCAGCACAGCCGG
GAGGGGCCGGCCTCTTGGAGAGAAGGCCGCGGGGCCTCCAGCAGTGTGCACTCGGGACAG
AAACCAGGCTCGCGCCTGCCCCAGGAGGGGAACAGCCACCAGGAAGGGGACACGGAGGCG
CTGCAGCATGGCGCAGAGGGGCCCTGCTCCTGCTCGGAGTGTGGCGAGCGCTCCCCTATG
AGCGCCAGGCTCGCCAGCCCCTGCAGGGCGCATACTGGAGAAAAGCCCTTCCAGTGTGCG
CATTGCACCAAGCGCTTCCGCCTGCGCCGCCTGCTGCAGGTCCACCAGCACGCGCACGGT
GGGGAGAGACCGTTCTCCTGCAGGAAGTGTGGCAAGGGCTTCGCCAAGCAGTGTAAACTC
ACGGAGCACATTCGAGTCCACAGCGGAGAGAAGCCTTTCCGGTGTGCCAAGTGTGGCAGG
AACTTCCGTCAGAGGGGACAGCTGCTGCGGCACCAGCGGCTGCACACGGACGAGAAGCCC
TTTCAGTGCCCAGAGTGTGGGCTGAGCTTCCGCCTGGAGAGCATGCTGAGAGCCCACCGG
CTCCGGCACGGTGGGGAGAGGCCGTTCTCCTGTAGCGAGTGTGGCAGAGGCTTCACCCAC
CAGTGCAAGCTCCGTGAGCACCTGAGAGTGCACAGCGGGGAGAGGCCCTTCCAGTGCCTG
AAGTGCGACAAGCGCTTCCGCCTGAAGGGCATCCTGAAGGCCCACCAGCACACGCACAGC
AAGGAGAGGCCGTTCTCGTGCGGGGAGTGTGGCAAGGGCTTCACCAGACAATCCAAGCTC
ACGGAGCACTTGCGCGTGCACAGCGGGGAGAGACCCTTCCAGTGCCCAGAGTGCAACAGG
AGCTTCCGCCTGAAGGGGCAGCTGCTCAGCCATCAGCGCCTGCACACGGGAGAGAGGCCC
TTCCAGTGTCCGGAGTGCGACAAGCGCTATCGCGTGAAGGCCGACATGAAGGCCCACCAG
CTGCTGCACAGCGGGGAGATGCCTTTCTCCTGTGAGTGCGGCAAGGGCTTTGTGAAACAC
TCAAAGCTCATCGAGCACATCAGAACGCACACGGGAGAGAAGCCTTTTCAGTGTCCCAAG
TGTGACAAGAGTTTCCGCCTGAAGGCGCAGCTGCTCAGCCATCAGGGCCTGCACACAGGG
GAGAGGCCTTTTCACTGCCCTGAGTGTGACAAGAACTTTTGGGAAAGGGGACACATGCTG
AGGCACCAGCGCATCCACAGGCCCGAGAGGCCCTTTGCCTGTGGCGATTGTGGGAAGGGC
TTCATTTACAAGTCTAAGCTTGCGGAGCACATCAGAGTACACACAAAATCCTGTCCTGCT
CCAAATGAACTGGACATTAAGAAAAGGCTCAGCCAACTGTTTGCAATGATAGAGGCCGAT
TGGAGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2404
Start on reference sequence 56
Mutations:
None
Discrepancy:
a1509c,Q503H
                                

5' Linker Sequence:
gtacaaaaaagctggcaCC

3' Linker Sequence:
GGCGacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ZNF786
Symbol Nomenclature : ZNF786
Full Nomenclature : zinc finger protein 786
GENEID : 136051
GI : 117644511
GenBank Accession : AM392873
HGNC : 21806
Vega : OTTHUMG00000158975
Target GenBank: AL834510

 

Reference Sequence Alignment

  

HsCD00081448      ATGGCGGAGCCGCCTCGGCTACCTCTGACTTTTGAGGATGTTGCTATTTATTTCTCCGAG
NM_152411.3       ATGGCGGAGCCGCCTCGGCTACCTCTGACTTTTGAGGATGTTGCTATTTATTTCTCCGAG
                  ************************************************************

HsCD00081448      CAAGAATGGCAGGATCTAGAGGCATGGCAGAAGGAACTTTACAAGCATGTGATGAGAAGC
NM_152411.3       CAAGAATGGCAGGATCTAGAGGCATGGCAGAAGGAACTTTACAAGCATGTGATGAGAAGC
                  ************************************************************

HsCD00081448      AATTATGAGACTCTCGTCTCTCTAGATGATGGACTTCCAAAACCAGAACTAATATCCTGG
NM_152411.3       AATTATGAGACTCTCGTCTCTCTAGATGATGGACTTCCAAAACCAGAACTAATATCCTGG
                  ************************************************************

HsCD00081448      ATTGAACACGGGGGAGAGCCCTTCAGGAAATGGAGAGAATCACAGAAATCAGGAAACATA
NM_152411.3       ATTGAACACGGGGGAGAGCCCTTCAGGAAATGGAGAGAATCACAGAAATCAGGAAACATA
                  ************************************************************

HsCD00081448      ATTTGCTCCTCTGTTGATATGCATTTTGATCCAGGTTTTGAGGAACAGCTGTTTTGGGGA
NM_152411.3       ATTTGCTCCTCTGTTGATATGCATTTTGATCCAGGTTTTGAGGAACAGCTGTTTTGGGGA
                  ************************************************************

HsCD00081448      AGCCAGCAGGCTATGAATTCAGGAAAAACTAAAAGCCATTTCCAATTAGATCCTGAAAGC
NM_152411.3       AGCCAGCAGGCTATGAATTCAGGAAAAACTAAAAGCCATTTCCAATTAGATCCTGAAAGC
                  ************************************************************

HsCD00081448      CAGTGTTCCTTTGGATCCTTTGTTTCCTTCAGGCCTGACCAAGGCATCACCCTCGGGAGC
NM_152411.3       CAGTGTTCCTTTGGATCCTTTGTTTCCTTCAGGCCTGACCAAGGCATCACCCTCGGGAGC
                  ************************************************************

HsCD00081448      CCACAGAGACACGACGCCAGGGCTCCTCCACCACTAGCCTGCGGCCCCAGTGAATCTACC
NM_152411.3       CCACAGAGACACGACGCCAGGGCTCCTCCACCACTAGCCTGCGGCCCCAGTGAATCTACC
                  ************************************************************

HsCD00081448      CTAAAAGAAGGAATCCCAGGTCCCAGAAATCTGGATCTTCCTGGTTTGTGGGACGTCCCC
NM_152411.3       CTAAAAGAAGGAATCCCAGGTCCCAGAAATCTGGATCTTCCTGGTTTGTGGGACGTCCCC
                  ************************************************************

HsCD00081448      GCCTGGGAGAGCACCCAGCACCCTTGGCCTGTCTGCGGGGAAAGCTGTTGGGAGAACAAC
NM_152411.3       GCCTGGGAGAGCACCCAGCACCCTTGGCCTGTCTGCGGGGAAAGCTGTTGGGAGAACAAC
                  ************************************************************

HsCD00081448      CATTTAGTAATGCACCAGAGAGGCCACTCAAAGGACCGGACACGTAGGGCCTGGGAGAAA
NM_152411.3       CATTTAGTAATGCACCAGAGAGGCCACTCAAAGGACCGGACACGTAGGGCCTGGGAGAAA
                  ************************************************************

HsCD00081448      TTCAACAAGAGGGCGGAGACGCAGATGCCGTGGAGCAGCCCTCGGGTACAGAGGCACTTC
NM_152411.3       TTCAACAAGAGGGCGGAGACGCAGATGCCGTGGAGCAGCCCTCGGGTACAGAGGCACTTC
                  ************************************************************

HsCD00081448      CGGTGTGGCGTGTGCGGTAAGAGCTTCCGCCGGAAGCTGTGTCTGCTGCGCCATCTGGCG
NM_152411.3       CGGTGTGGCGTGTGCGGTAAGAGCTTCCGCCGGAAGCTGTGTCTGCTGCGCCATCTGGCG
                  ************************************************************

HsCD00081448      GCCCACACGGGGAGGGGCCCCTTCCGGAACGCTGACGGTGAAATGTGCTTCCGACACGAG
NM_152411.3       GCCCACACGGGGAGGGGCCCCTTCCGGAACGCTGACGGTGAAATGTGCTTCCGACACGAG
                  ************************************************************

HsCD00081448      CTGACCCATCCCAGCCACCGCCTCCCGCAGCAGGGGGAGAAGCCTGCCCAGTGCACCCCA
NM_152411.3       CTGACCCATCCCAGCCACCGCCTCCCGCAGCAGGGGGAGAAGCCTGCCCAGTGCACCCCA
                  ************************************************************

HsCD00081448      TGCGGCAAGCGCTCCCTCCCAGTGGACAGCACGCAGGCTCGCCGGTGCCAGCACAGCCGG
NM_152411.3       TGCGGCAAGCGCTCCCTCCCAGTGGACAGCACGCAGGCTCGCCGGTGCCAGCACAGCCGG
                  ************************************************************

HsCD00081448      GAGGGGCCGGCCTCTTGGAGAGAAGGCCGCGGGGCCTCCAGCAGTGTGCACTCGGGACAG
NM_152411.3       GAGGGGCCGGCCTCTTGGAGAGAAGGCCGCGGGGCCTCCAGCAGTGTGCACTCGGGACAG
                  ************************************************************

HsCD00081448      AAACCAGGCTCGCGCCTGCCCCAGGAGGGGAACAGCCACCAGGAAGGGGACACGGAGGCG
NM_152411.3       AAACCAGGCTCGCGCCTGCCCCAGGAGGGGAACAGCCACCAGGAAGGGGACACGGAGGCG
                  ************************************************************

HsCD00081448      CTGCAGCATGGCGCAGAGGGGCCCTGCTCCTGCTCGGAGTGTGGCGAGCGCTCCCCTATG
NM_152411.3       CTGCAGCATGGCGCAGAGGGGCCCTGCTCCTGCTCGGAGTGTGGCGAGCGCTCCCCTATG
                  ************************************************************

HsCD00081448      AGCGCCAGGCTCGCCAGCCCCTGCAGGGCGCATACTGGAGAAAAGCCCTTCCAGTGTGCG
NM_152411.3       AGCGCCAGGCTCGCCAGCCCCTGCAGGGCGCATACTGGAGAAAAGCCCTTCCAGTGTGCG
                  ************************************************************

HsCD00081448      CATTGCACCAAGCGCTTCCGCCTGCGCCGCCTGCTGCAGGTCCACCAGCACGCGCACGGT
NM_152411.3       CATTGCACCAAGCGCTTCCGCCTGCGCCGCCTGCTGCAGGTCCACCAGCACGCGCACGGT
                  ************************************************************

HsCD00081448      GGGGAGAGACCGTTCTCCTGCAGGAAGTGTGGCAAGGGCTTCGCCAAGCAGTGTAAACTC
NM_152411.3       GGGGAGAGACCGTTCTCCTGCAGGAAGTGTGGCAAGGGCTTCGCCAAGCAGTGTAAACTC
                  ************************************************************

HsCD00081448      ACGGAGCACATTCGAGTCCACAGCGGAGAGAAGCCTTTCCGGTGTGCCAAGTGTGGCAGG
NM_152411.3       ACGGAGCACATTCGAGTCCACAGCGGAGAGAAGCCTTTCCGGTGTGCCAAGTGTGGCAGG
                  ************************************************************

HsCD00081448      AACTTCCGTCAGAGGGGACAGCTGCTGCGGCACCAGCGGCTGCACACGGACGAGAAGCCC
NM_152411.3       AACTTCCGTCAGAGGGGACAGCTGCTGCGGCACCAGCGGCTGCACACGGACGAGAAGCCC
                  ************************************************************

HsCD00081448      TTTCAGTGCCCAGAGTGTGGGCTGAGCTTCCGCCTGGAGAGCATGCTGAGAGCCCACCGG
NM_152411.3       TTTCAGTGCCCAGAGTGTGGGCTGAGCTTCCGCCTGGAGAGCATGCTGAGAGCCCACCGG
                  ************************************************************

HsCD00081448      CTCCGGCACGGTGGGGAGAGGCCGTTCTCCTGTAGCGAGTGTGGCAGAGGCTTCACCCAC
NM_152411.3       CTCCGGCACGGTGGGGAGAGGCCGTTCTCCTGTAGCGAGTGTGGCAGAGGCTTCACCCAC
                  ************************************************************

HsCD00081448      CAGTGCAAGCTCCGTGAGCACCTGAGAGTGCACAGCGGGGAGAGGCCCTTCCAGTGCCTG
NM_152411.3       CAGTGCAAGCTCCGTGAGCACCTGAGAGTGCACAGCGGGGAGAGGCCCTTCCAGTGCCTG
                  ************************************************************

HsCD00081448      AAGTGCGACAAGCGCTTCCGCCTGAAGGGCATCCTGAAGGCCCACCAGCACACGCACAGC
NM_152411.3       AAGTGCGACAAGCGCTTCCGCCTGAAGGGCATCCTGAAGGCCCACCAGCACACGCACAGC
                  ************************************************************

HsCD00081448      AAGGAGAGGCCGTTCTCGTGCGGGGAGTGTGGCAAGGGCTTCACCAGACAATCCAAGCTC
NM_152411.3       AAGGAGAGGCCGTTCTCGTGCGGGGAGTGTGGCAAGGGCTTCACCAGACAATCCAAGCTC
                  ************************************************************

HsCD00081448      ACGGAGCACTTGCGCGTGCACAGCGGGGAGAGACCCTTCCAGTGCCCAGAGTGCAACAGG
NM_152411.3       ACGGAGCACTTGCGCGTGCACAGCGGGGAGAGACCCTTCCAGTGCCCAGAGTGCAACAGG
                  ************************************************************

HsCD00081448      AGCTTCCGCCTGAAGGGGCAGCTGCTCAGCCATCAGCGCCTGCACACGGGAGAGAGGCCC
NM_152411.3       AGCTTCCGCCTGAAGGGGCAGCTGCTCAGCCATCAGCGCCTGCACACGGGAGAGAGGCCC
                  ************************************************************

HsCD00081448      TTCCAGTGTCCGGAGTGCGACAAGCGCTATCGCGTGAAGGCCGACATGAAGGCCCACCAG
NM_152411.3       TTCCAGTGTCCGGAGTGCGACAAGCGCTATCGCGTGAAGGCCGACATGAAGGCCCACCAG
                  ************************************************************

HsCD00081448      CTGCTGCACAGCGGGGAGATGCCTTTCTCCTGTGAGTGCGGCAAGGGCTTTGTGAAACAC
NM_152411.3       CTGCTGCACAGCGGGGAGATGCCTTTCTCCTGTGAGTGCGGCAAGGGCTTTGTGAAACAC
                  ************************************************************

HsCD00081448      TCAAAGCTCATCGAGCACATCAGAACGCACACGGGAGAGAAGCCTTTTCAGTGTCCCAAG
NM_152411.3       TCAAAGCTCATCGAGCACATCAGAACGCACACGGGAGAGAAGCCTTTTCAGTGTCCCAAG
                  ************************************************************

HsCD00081448      TGTGACAAGAGTTTCCGCCTGAAGGCGCAGCTGCTCAGCCATCAGGGCCTGCACACAGGG
NM_152411.3       TGTGACAAGAGTTTCCGCCTGAAGGCGCAGCTGCTCAGCCATCAGGGCCTGCACACAGGG
                  ************************************************************

HsCD00081448      GAGAGGCCTTTTCACTGCCCTGAGTGTGACAAGAACTTTTGGGAAAGGGGACACATGCTG
NM_152411.3       GAGAGGCCTTTTCACTGCCCTGAGTGTGACAAGAACTTCCGGGAAAGGGGACACATGCTG
                  **************************************  ********************

HsCD00081448      AGGCACCAGCGCATCCACAGGCCCGAGAGGCCCTTTGCCTGTGGCGATTGTGGGAAGGGC
NM_152411.3       AGGCACCAGCGCATCCACAGGCCCGAGAGGCCCTTTGCCTGTGGCGATTGTGGGAAGGGC
                  ************************************************************

HsCD00081448      TTCATTTACAAGTCTAAGCTTGCGGAGCACATCAGAGTACACACAAAATCCTGTCCTGCT
NM_152411.3       TTCATTTACAAGTCTAAGCTTGCGGAGCACATCAGAGTACACACAAAATCCTGTCCTGCT
                  ************************************************************

HsCD00081448      CCAAATGAACTGGACATTAAGAAAAGGCTCAGCCAACTGTTTGCAATGATAGAGGCCGAT
NM_152411.3       CCAAATGAACTGGACATTAAGAAAAGGCTCAGCCAACTGTTTGCAATGATAGAGGCCGAT
                  ************************************************************

HsCD00081448      TGGAGT---
NM_152411.3       TGGAGTTGA
                  ******   

Pathways

Reactome : Gene Expression
Reactome : Generic Transcription Pathway

Protein

SMART domain : KRAB : krueppel associated box
SMART domain : ZnF_C2H2 : zinc finger
UniProt : Q8N393
HPRD : 13232

Clone

Cloning Information : 266072
HIP Master Clone ID : 198170
IMAGE ID : 100001872
Original Clone ID : FLH266072.01L

Organism


TAX_ID : 9606
Species Specific ID: 136051

Genome

Chromosome : 7
Map Location : 7q36.1
Ensembl : ENSG00000197362

Reagents

Labome : ZNF786-antibody