DNASU Plasmid Repository • 480.965.5697 | Email

ACTG2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ACTA1
Gene Name:  actin, alpha 1, skeletal muscle
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020486.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000817

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1131nts        
Open reading frame : 1 to 1131
Reference Sequence Alignment

ATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCA
GGCTTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGC
CACCAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCTCAG
AGCAAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAACTGG
GATGACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCTGAA
GAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAAAAGATG
ACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCTGTG
CTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGTC
ACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGAC
TTGGCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCC
TTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTG
GCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGC
TATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCTGAG
ACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACCTAC
AATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCTC
TCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCC
CTGGCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTC
TGGATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAAG
CCTGAGTATGATGAGGCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1211
Start on reference sequence 81
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ACTA1
Symbol Nomenclature : ACTA1
SYNONYM : ACTA; ASMA; CFTD; CFTD1; CFTDM; MPFD; NEM1; NEM2; NEM3
Designation : actin, alpha skeletal muscle|nemaline myopathy type 3
Full Nomenclature : actin, alpha 1, skeletal muscle
GENEID : 58
Locus Tag : RP5-1068B5.2
GI : 61367206
GenBank Accession : AY891034
HGNC : 129
MIM : 102610
Vega : OTTHUMG00000038006
Target GenBank: NM_001615

 

Reference Sequence Alignment

  

HsCD00000817        ---ATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAG
NM_005159.4         ATGTGTGACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAG
NM_001199954.1      ------ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAA
NM_001101.3         ------ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAG
NM_001615.3         ---ATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAG
NM_001141945.1      ATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAG
NM_001614.3         ------ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAA
NM_001100.3         ATGTGCGACGAAGACGAGACCACCGCCCTCGTGTGCGACAATGGCTCCGGCCTGGTGAAA
NM_001613.2         ATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAG
                             ** ** ** * *.* **  * **    ***** ***** ** .*    **.

HsCD00000817        GCAGGCTTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCT
NM_005159.4         GCCGGCTTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCG
NM_001199954.1      GCTGGTTTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCC
NM_001101.3         GCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCC
NM_001615.3         GCAGGCTTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCT
NM_001141945.1      GCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCC
NM_001614.3         GCTGGTTTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCC
NM_001100.3         GCCGGCTTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCCATCGTGGGCCGCCCC
NM_001613.2         GCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCC
                    ** ** ** ** ** ** ** ** ** .* ** ** ** ** ***** ** ** ** ** 

HsCD00000817        CGCCACCAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCT
NM_005159.4         CGGCACCAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCC
NM_001199954.1      AGACACCAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCC
NM_001101.3         AGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCC
NM_001615.3         CGCCACCAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCT
NM_001141945.1      AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCA
NM_001614.3         AGACACCAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCC
NM_001100.3         CGACACCAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACGAGGCT
NM_001613.2         AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCA
                    .* ** ***** ** ***** ** ***** **.**.** : *** **.** ** **.** 

HsCD00000817        CAGAGCAAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAAC
NM_005159.4         CAGAGCAAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCAAC
NM_001199954.1      CAGAGCAAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAAC
NM_001101.3         CAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAAC
NM_001615.3         CAGAGCAAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAAC
NM_001141945.1      CAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAAC
NM_001614.3         CAGAGCAAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAAC
NM_001100.3         CAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAAC
NM_001613.2         CAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAAC
                    ********..*:** ***** ** ** **.** ** ** **.** ** ***.********

HsCD00000817        TGGGATGACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCT
NM_005159.4         TGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTCCGTGTGGCTCCC
NM_001199954.1      TGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCG
NM_001101.3         TGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCC
NM_001615.3         TGGGATGACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCT
NM_001141945.1      TGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCT
NM_001614.3         TGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCG
NM_001100.3         TGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCC
NM_001613.2         TGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCT
                    ***** ********.**.************:* ******** ***** ** ** ** ** 

HsCD00000817        GAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAAAAG
NM_005159.4         GAGGAGCACCCCACCCTGCTCACAGAGGCCCCGCTGAACCCCAAGGCCAACCGGGAGAAG
NM_001199954.1      GAGGAGCACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAG
NM_001101.3         GAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAG
NM_001615.3         GAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAAAAG
NM_001141945.1      GAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAA
NM_001614.3         GAGGAGCACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAG
NM_001100.3         GAGGAGCACCCCACCCTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAG
NM_001613.2         GAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAA
                    **.***** **..  ***** ** ***** ** ** ** ************.* **.**.

HsCD00000817        ATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCT
NM_005159.4         ATGACTCAGATCATGTTTGAGACCTTCAATGTCCCTGCCATGTACGTGGCCATCCAGGCA
NM_001199954.1      ATGACTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCC
NM_001101.3         ATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCT
NM_001615.3         ATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCT
NM_001141945.1      ATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCG
NM_001614.3         ATGACTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCC
NM_001100.3         ATGACCCAGATCATGTTTGAGACCTTCAACGTGCCCGCCATGTACGTGGCCATCCAGGCC
NM_001613.2         ATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCG
                    ***** **.** ********.** ***** .  ** ******** ** ** ** **.** 

HsCD00000817        GTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGC
NM_005159.4         GTGCTATCCCTGTATGCTTCTGGCCGTACCACAGGCATTGTTCTGGACTCTGGGGATGGT
NM_001199954.1      GTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGG
NM_001101.3         GTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGG
NM_001615.3         GTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGC
NM_001141945.1      GTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGT
NM_001614.3         GTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGG
NM_001100.3         GTGCTGTCCCTCTACGCCTCCGGCAGGACCACCGGCATCGTGCTGGACTCCGGCGACGGC
NM_001613.2         GTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGT
                    ***** ** ** ** ** ** ** .* ** ** ***** ** .**** ** ** ** ** 

HsCD00000817        GTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTG
NM_005159.4         GTAACTCACAATGTCCCCATCTATGAGGGCTACGCTTTGCCCCATGCCATCATGCGTCTG
NM_001199954.1      GTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTG
NM_001101.3         GTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTG
NM_001615.3         GTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTG
NM_001141945.1      GTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTG
NM_001614.3         GTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTG
NM_001100.3         GTCACCCACAACGTGCCCATTTATGAGGGCTACGCGCTGCCGCACGCCATCATGCGCCTG
NM_001613.2         GTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTG
                    **.** ****. ** ***** ** **.** ** **  * ** ** ******.**** ***

HsCD00000817        GACTTGGCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTAT
NM_005159.4         GATCTGGCTGGTCGGGACCTCACTGACTACCTCATGAAGATCCTCACTGAGCGTGGCTAC
NM_001199954.1      GACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTAC
NM_001101.3         GACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTAC
NM_001615.3         GACTTGGCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTAT
NM_001141945.1      GATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTAT
NM_001614.3         GACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTAC
NM_001100.3         GACCTGGCGGGCCGCGATCTCACCGACTACCTGATGAAGATCCTCACTGAGCGTGGCTAC
NM_001613.2         GATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTAT
                    **  **** ** ** ** ** ** ******** *********** ** ***.* ***** 

HsCD00000817        TCCTTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTAT
NM_005159.4         TCCTTTGTCACCACTGCTGAACGTGAAATTGTCCGTGACATTAAAGAGAAGCTGTGCTAT
NM_001199954.1      AGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTAC
NM_001101.3         AGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTAC
NM_001615.3         TCCTTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTAT
NM_001141945.1      TCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTAT
NM_001614.3         AGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTAC
NM_001100.3         TCCTTCGTGACCACAGCTGAGCGCGAGATCGTGCGCGACATCAAGGAGAAGCTGTGCTAC
NM_001613.2         TCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTAT
                    : *** .  ** ** ** **..* **.** ** ** ***** **.*****.***** ** 

HsCD00000817        GTGGCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAG
NM_005159.4         GTCGCCCTGGATTTTGAGAATGAGATGGCCACAGCTGCCTCTTCCTCCTCCCTGGAGAAG
NM_001199954.1      GTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAG
NM_001101.3         GTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAG
NM_001615.3         GTGGCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAG
NM_001141945.1      GTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAG
NM_001614.3         GTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAG
NM_001100.3         GTGGCCCTGGACTTCGAGAACGAGATGGCGACGGCCGCCTCCTCCTCCTCCCTGGAAAAG
NM_001613.2         GTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAG
                    ** ** ***** ** **..* ******** ** ** ** ** :  ** ** ** **.***

HsCD00000817        AGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCT
NM_005159.4         AGCTATGAACTGCCTGATGGCCAAGTCATCACTATTGGCAATGAGCGCTTCCGCTGTCCT
NM_001199954.1      AGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCG
NM_001101.3         AGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCT
NM_001615.3         AGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCT
NM_001141945.1      AGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCA
NM_001614.3         AGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCG
NM_001100.3         AGCTACGAGCTGCCAGACGGGCAGGTCATCACCATCGGCAACGAGCGCTTCCGCTGCCCG
NM_001613.2         AGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCA
                    ** ** **. **** ** ** **.** ***** ** **.** **.** ***** ** ** 

HsCD00000817        GAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACC
NM_005159.4         GAGACACTCTTCCAGCCCTCCTTCATTGGTATGGAATCTGCTGGCATCCATGAAACAACT
NM_001199954.1      GAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACC
NM_001101.3         GAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACC
NM_001615.3         GAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACC
NM_001141945.1      GAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACC
NM_001614.3         GAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACC
NM_001100.3         GAGACGCTCTTCCAGCCCTCCTTCATCGGTATGGAGTCGGCGGGCATTCACGAGACCACC
NM_001613.2         GAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACC
                    ***.* ** ******** ***** .* ** *****.**    **.** ** **.** ** 

HsCD00000817        TACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTC
NM_005159.4         TACAATAGCATCATGAAGTGTGACATTGATATCCGCAAGGACCTGTATGCCAACAATGTC
NM_001199954.1      TTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTG
NM_001101.3         TTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTG
NM_001615.3         TACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTC
NM_001141945.1      TACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTC
NM_001614.3         TTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTG
NM_001100.3         TACAACAGCATCATGAAGTGTGACATCGACATCAGGAAGGACCTGTATGCCAACAACGTC
NM_001613.2         TACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTC
                    *:*** : *************** .* ** ***.* **.*** * ** ** ****. ** 

HsCD00000817        CTCTCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACA
NM_005159.4         TTATCTGGAGGCACCACTATGTACCCTGGTATTGCTGATCGTATGCAGAAGGAAATCACT
NM_001199954.1      CTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACC
NM_001101.3         CTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACT
NM_001615.3         CTCTCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACA
NM_001141945.1      CTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACG
NM_001614.3         CTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACC
NM_001100.3         ATGTCGGGGGGCACCACGATGTACCCTGGGATCGCTGACCGCATGCAGAAAGAGATCACC
NM_001613.2         CTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACG
                     * ** ** ******** ******** ** ** ** ** .* ********.**.***** 

HsCD00000817        GCCCTGGCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCA
NM_005159.4         GCTCTGGCTCCTAGCACCATGAAGATTAAGATTATTGCTCCCCCTGAGCGTAAATACTCT
NM_001199954.1      GCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCG
NM_001101.3         GCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCC
NM_001615.3         GCCCTGGCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCA
NM_001141945.1      GCCCTAGCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCT
NM_001614.3         GCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCG
NM_001100.3         GCGCTGGCACCCAGCACCATGAAGATCAAGATCATCGCCCCGCCGGAGCGCAAATACTCG
NM_001613.2         GCCCTAGCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCT
                    ** **.** ** *****.******** ***** ** ** ** ** ***** **.***** 

HsCD00000817        GTCTGGATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGC
NM_005159.4         GTCTGGATTGGGGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAAATGTGGATTAGC
NM_001199954.1      GTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGC
NM_001101.3         GTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGC
NM_001615.3         GTCTGGATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGC
NM_001141945.1      GTCTGGATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGC
NM_001614.3         GTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGC
NM_001100.3         GTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCACC
NM_001613.2         GTCTGGATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGC
                    ** ***** ** ***** *********** ** **************.******** * *

HsCD00000817        AAGCCTGAGTATGATGAGGCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTTG
NM_005159.4         AAGCAAGAGTACGATGAGGCAGGCCCATCCATTGTCCACCGCAAATGCTTCTAA
NM_001199954.1      AAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
NM_001101.3         AAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG
NM_001615.3         AAGCCTGAGTATGATGAGGCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTAA
NM_001141945.1      AAACAGGAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAA
NM_001614.3         AAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
NM_001100.3         AAGCAGGAGTACGACGAGGCCGGCCCTTCCATCGTCCACCGCAAATGCTTCTAG
NM_001613.2         AAACAGGAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAA
                    **.*. **.** ** **. * ** ** ***** ******.* **.*******:.

Pathways

Panther : Alzheimer disease-presenilin pathway
Panther : Cadherin signaling pathway
Panther : Cytoskeletal regulation by Rho GTPase
Panther : Huntington disease
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Panther : Wnt signaling pathway
Reactome : Muscle contraction
Reactome : Smooth Muscle Contraction

Protein

SMART domain : ACTIN : Actin
UniProt : E9PG30
UniProt : B4E315
UniProt : P63267
HPRD : 00030

Clone

Cloning Information : 20486
HIP Master Clone ID : 36832
Original Clone ID : FLH020486.01L

Organism


TAX_ID : 9606
Species Specific ID: 72

Genome

Chromosome : 1
Map Location : 1q42.13
Ensembl : ENSG00000143632

Reagents

Labome : ACTG2-antibody