DNASU Plasmid Repository • 480.965.5697 | Email

TJP2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TJP2
Gene Name:  tight junction protein 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH266423.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00081799

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3573nts         Open reading frame : 1 to 3573
Reference Sequence Alignment

ATGCCGGTGCGAGGAGACCGCGGGTTTCCACCCCGGCGGGAGCTGTCAGGTTGGCTCCGC
GCCCCAGGCATGGAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCC
AAAAGAGGATTTGGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGA
GAAACGTCAATTGTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAA
GAAAATGACAGAGTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTT
GCAGTTCAGCAGCTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGG
AAGGTCCAGGTGGCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTT
GAGGTGATGGACGAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGG
CTGAACAGCCATGGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCC
CATGAGCGGGCCCGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGC
CTGGAGCGGGGCCTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGC
CTGGAGCGGGGCCTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGC
CGCGGCCGGAGCATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGAC
TACGAGCGGGCCTACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGG
GGACCCCGAAGCCGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGG
GGGCGGCCGGGGCCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGT
CTCCGGCTTGGGAGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAA
GATGGCAACCTTCACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAAC
ATGTCTTTAACGGATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTG
GTGTTGAGAGACAGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCA
GAAATAGAAGATATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGT
CATCAGTATTCTGATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGT
TCCAGAGAGGACACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAG
TCCACAGGGGATATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAA
GAGGACCCCCCAGCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCT
GAAGATGAAGCAATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGC
GTGGGCCTCCGGTTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAA
GGGACCTCGGCGGAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACA
CAGGATTTCAGAGGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAA
GGTGAAATGGTGACCATTTTAGCTCAGAGCCGAGCTGATGTGTATAGAGACATCCTGGCT
TGTGGCAGAGGGGATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCA
CAGAGCCTGGCCTTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGC
AAGCTGGGCAACTGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCC
AACAAGAGCAGAGCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGG
GACCGGGCAGATTTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGG
AAAAGTCGGGAAGACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAG
AGGGTTTTGCTGCGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCT
GATATAGCAATGGAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACG
GAACCAAAAGATGCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGG
CAAATTATTGAGCAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTG
TTGAATTACACCCAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGT
GTCAAAACCATGAGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTT
GATCAAGCCAACAAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTA
AATTCAGCCAATGATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGA
GAAGCGGTTTGGGTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGC
ATGTCCTACTTAACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGT
GACTTTGAAGACACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCA
GCCGAGGAGCCGCTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAG
AGCATAAGGAAACCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGAT
CAACTTAGGGACAATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACC
CAGAACAAAGAAGAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCT
GCCGTTGCTGGTAATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCA
GCAAAACCTACCTTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAG
GGTGAGGAGGTGGGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGC
AAAGTCAAAATATTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTC
CAGGAAGCACAGAATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTT
CCAATCAAAACGCACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCT
GAGCCACAGAAAGCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGAT
GCCGAGGAGGAGGAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGC
CAGTCTGCCCGATACCGGGACACAGAATTATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3782
Start on reference sequence 210
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
ATCCACCCAGCTTTCTTGTACA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TJP2
Symbol Nomenclature : TJP2
SYNONYM : C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2
Designation : Friedreich ataxia region gene X104 (tight junction protein ZO-2)|tight junction protein ZO-2|zona occludens 2|zonula occludens protein 2
Full Nomenclature : tight junction protein 2
GENEID : 9414
Locus Tag : RP11-16N10.1
GI : 117644757
GenBank Accession : AM392967
HGNC : 11828
MIM : 607709
Vega : OTTHUMG00000019978
Target GenBank: BC027592

 

Reference Sequence Alignment

  

HsCD00081799        ------------------------------------------------------------
XM_005252315.1      ATGAGGTACAAGAAATATATCGGTATTCTGGAAGCAGCAGTTGGTATTACCCCACTTAAC
XM_005252313.1      ATGAGGTACAAGAAATATATCGGTATTCTGGAAGCAGCAGTTGGTATTACCCCACTTAAC
NM_001170415.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
NM_004817.3         ------------------------------------------------------------
XM_005252311.1      ATGAGGTACAAGAAATATATCGGTATTCTGGAAGCAGCAGTTGGTATTACCCCACTTAAC
XM_005252314.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------------------
                                                                                

HsCD00081799        ------------------------------------------------------------
XM_005252315.1      AAAAGAGAACTTCTACCTGAGAGCAGAAGACACGTGAACCTTTGGCAACAACCTGGGGTG
XM_005252313.1      AAAAGAGAACTTCTACCTGAGAGCAGAAGACACGTGAACCTTTGGCAACAACCTGGGGTG
NM_001170415.1      ------------------------------------------------------------
NM_001170416.1      ------------------------------------------------------------
NM_004817.3         ------------------------------------------------------------
XM_005252311.1      AAAAGAGAACTTCTACCTGAGAGCAGAAGACACGTGAACCTTTGGCAACAACCTGGGGTG
XM_005252314.1      ------------------------------------------------------------
XM_005252312.1      ------------------------------------------------ATGGCTGGGGTG
                                                                                

HsCD00081799        --------------ATGCCGGTGCGAGGAGACCGCGGGTTTCCACCCCGGCGGGAGCTGT
XM_005252315.1      CGAAGTACCACATTACTGTCATCTCCCTGTGAGTGGGATTGGCACCCCGGCTGCAGCTCC
XM_005252313.1      CGAAGTACCACATTACTGTCATCTCCCTGTGAGTGGGATTGGCACCCCGGCTGCAGCTCC
NM_001170415.1      ----------ATGAAGACTGCTCAAGCCCTACATAGGATGTGGATCCAGGCTGTTAAAAA
NM_001170416.1      ----------ATGAAGACTGCTCAAGCCCTACATAGGATGTGGATCCAGGCTGTTAAAAA
NM_004817.3         --------------ATGCCGGTGCGAGGAGACCGCGGGTTTCCACCCCGGCGGGAGCTGT
XM_005252311.1      CGAAGTACCACATTACTGTCATCTCCCTGTGAGTGGGATTGGCACCCCGGCTGCAGCTCC
XM_005252314.1      ----------ATGAAGACTGCTCAAGCCCTACATAGGATGTGGATCCAGGCTGTTAAAAA
XM_005252312.1      CGAAGTACCACATTACTGTCATCTCCCTGTGAGTGGGATTGGCACCCCGGCTGCAGCTCC
                                  *      *        ..   **.*    * **.*** * :..:  

HsCD00081799        CAGGTTGG----------------------------------------------------
XM_005252315.1      AGGAGCAAGTACTCCAGGAAGCACAGAGCTGTACCAGTACACGGCCCACG----------
XM_005252313.1      AGGAGCAAGTACTCCAGGAAGCACAGAGCTGTACCAGTACACGGCCCACG----------
NM_001170415.1      GTTGAGGAGATG-----GAAAG--------------------------------------
NM_001170416.1      GTTGAGGAGATG-----GAAAGGCCGTGTGAGTCCCTCTGCAAGCTCTCCCCTTGTTTTC
NM_004817.3         CAGGTTGG----------------------------------------------------
XM_005252311.1      AGGAGCAAGTACTCCAGGAAGCACAGAGCTGTACCAGTACACGGCCCACG----------
XM_005252314.1      GTTGAGGAGATGGAAAG-------------------------------------------
XM_005252312.1      AGGAGCAAGTACTCCAGGAAGCACAGAGCTGTACCAGTACACGGCCCACG----------
                       .  ..                                                    

HsCD00081799        ------------------------------------------CTCCGCGCCCCAGGCATG
XM_005252315.1      -----------------------------------------TTGCCAGGCCCCAGGCATG
XM_005252313.1      -----------------------------------------TTGCCAGGCCCCAGGCATG
NM_001170415.1      -------------------------------------------GCCGTGCCCCAGGCATG
NM_001170416.1      CCCAACCTTTCTTCATGGGAAGGGGAGGGAAGCAAAACCATTCTCACAGCCCCAGGCATG
NM_004817.3         ------------------------------------------CTCCGCGCCCCAGGCATG
XM_005252311.1      -----------------------------------------TTGCCAGGCCCCAGGCATG
XM_005252314.1      -------------------------------------------GCCGTGCCCCAGGCATG
XM_005252312.1      -----------------------------------------TTGCCAGGCCCCAGGCATG
                                                                *.  ************

HsCD00081799        GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
XM_005252315.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
XM_005252313.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
NM_001170415.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
NM_001170416.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
NM_004817.3         GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
XM_005252311.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
XM_005252314.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
XM_005252312.1      GAAGAGCTGATATGGGAACAGTACACTGTGACCCTACAAAAGGATTCCAAAAGAGGATTT
                    ************************************************************

HsCD00081799        GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
XM_005252315.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
XM_005252313.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
NM_001170415.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
NM_001170416.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
NM_004817.3         GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
XM_005252311.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
XM_005252314.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
XM_005252312.1      GGAATTGCAGTGTCCGGAGGCAGAGACAACCCCCACTTTGAAAATGGAGAAACGTCAATT
                    ************************************************************

HsCD00081799        GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
XM_005252315.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
XM_005252313.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
NM_001170415.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
NM_001170416.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
NM_004817.3         GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
XM_005252311.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
XM_005252314.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
XM_005252312.1      GTCATTTCTGATGTGCTCCCGGGTGGGCCTGCTGATGGGCTGCTCCAAGAAAATGACAGA
                    ************************************************************

HsCD00081799        GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
XM_005252315.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
XM_005252313.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
NM_001170415.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
NM_001170416.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
NM_004817.3         GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
XM_005252311.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
XM_005252314.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
XM_005252312.1      GTGGTCATGGTCAATGGCACCCCCATGGAGGATGTGCTTCATTCGTTTGCAGTTCAGCAG
                    ************************************************************

HsCD00081799        CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
XM_005252315.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
XM_005252313.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
NM_001170415.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
NM_001170416.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
NM_004817.3         CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
XM_005252311.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
XM_005252314.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
XM_005252312.1      CTCAGAAAAAGTGGGAAGGTCGCTGCTATTGTGGTCAAGAGGCCCCGGAAGGTCCAGGTG
                    ************************************************************

HsCD00081799        GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
XM_005252315.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
XM_005252313.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
NM_001170415.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
NM_001170416.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
NM_004817.3         GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
XM_005252311.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
XM_005252314.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
XM_005252312.1      GCCGCACTTCAGGCCAGCCCTCCCCTGGATCAGGATGACCGGGCTTTTGAGGTGATGGAC
                    ************************************************************

HsCD00081799        GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
XM_005252315.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
XM_005252313.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
NM_001170415.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
NM_001170416.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
NM_004817.3         GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
XM_005252311.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
XM_005252314.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
XM_005252312.1      GAGTTTGATGGCAGAAGTTTCCGGAGTGGCTACAGCGAGAGGAGCCGGCTGAACAGCCAT
                    ************************************************************

HsCD00081799        GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
XM_005252315.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
XM_005252313.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
NM_001170415.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
NM_001170416.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
NM_004817.3         GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
XM_005252311.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
XM_005252314.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
XM_005252312.1      GGGGGGCGCAGCCGCAGCTGGGAGGACAGCCCGGAAAGGGGGCGTCCCCATGAGCGGGCC
                    ************************************************************

HsCD00081799        CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252315.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252313.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
NM_001170415.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
NM_001170416.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
NM_004817.3         CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252311.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252314.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252312.1      CGGAGCCGGGAGCGGGACCTCAGCCGGGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGGC
                    ************************************************************

HsCD00081799        CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252315.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252313.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
NM_001170415.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
NM_001170416.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
NM_004817.3         CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252311.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252314.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
XM_005252312.1      CTGGACCAAGACCATGCGCGCACCCGAGACCGCAGCCGTGGCCGGAGCCTGGAGCGGGGC
                    ************************************************************

HsCD00081799        CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
XM_005252315.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
XM_005252313.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
NM_001170415.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
NM_001170416.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
NM_004817.3         CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
XM_005252311.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
XM_005252314.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
XM_005252312.1      CTGGACCACGACTTTGGGCCATCCCGGGACCGGGACCGTGACCGCAGCCGCGGCCGGAGC
                    ************************************************************

HsCD00081799        ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
XM_005252315.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
XM_005252313.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
NM_001170415.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
NM_001170416.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
NM_004817.3         ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
XM_005252311.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
XM_005252314.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
XM_005252312.1      ATTGACCAGGACTACGAGCGAGCCTATCACCGGGCCTACGACCCAGACTACGAGCGGGCC
                    ************************************************************

HsCD00081799        TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
XM_005252315.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
XM_005252313.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
NM_001170415.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
NM_001170416.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
NM_004817.3         TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
XM_005252311.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
XM_005252314.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
XM_005252312.1      TACAGCCCGGAGTACAGGCGCGGGGCCCGCCACGATGCCCGCTCTCGGGGACCCCGAAGC
                    ************************************************************

HsCD00081799        CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
XM_005252315.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
XM_005252313.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
NM_001170415.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
NM_001170416.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
NM_004817.3         CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
XM_005252311.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
XM_005252314.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
XM_005252312.1      CGCAGCCGCGAGCACCCGCACTCACGGAGCCCCAGCCCCGAGCCTAGGGGGCGGCCGGGG
                    ************************************************************

HsCD00081799        CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
XM_005252315.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
XM_005252313.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
NM_001170415.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
NM_001170416.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
NM_004817.3         CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
XM_005252311.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
XM_005252314.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
XM_005252312.1      CCCATCGGGGTCCTCCTGATGAAAAGCAGAGCGAACGAAGAGTATGGTCTCCGGCTTGGG
                    ************************************************************

HsCD00081799        AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
XM_005252315.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
XM_005252313.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
NM_001170415.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
NM_001170416.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
NM_004817.3         AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
XM_005252311.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
XM_005252314.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
XM_005252312.1      AGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTT
                    ************************************************************

HsCD00081799        CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
XM_005252315.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
XM_005252313.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
NM_001170415.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
NM_001170416.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
NM_004817.3         CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
XM_005252311.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
XM_005252314.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
XM_005252312.1      CACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACG
                    ************************************************************

HsCD00081799        GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
XM_005252315.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
XM_005252313.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
NM_001170415.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
NM_001170416.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
NM_004817.3         GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
XM_005252311.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
XM_005252314.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
XM_005252312.1      GATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGAC
                    ************************************************************

HsCD00081799        AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
XM_005252315.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
XM_005252313.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
NM_001170415.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
NM_001170416.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
NM_004817.3         AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
XM_005252311.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
XM_005252314.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
XM_005252312.1      AGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGAT
                    ************************************************************

HsCD00081799        ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
XM_005252315.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
XM_005252313.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
NM_001170415.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
NM_001170416.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
NM_004817.3         ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
XM_005252311.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
XM_005252314.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
XM_005252312.1      ATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCT
                    ************************************************************

HsCD00081799        GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
XM_005252315.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
XM_005252313.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
NM_001170415.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
NM_001170416.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
NM_004817.3         GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
XM_005252311.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
XM_005252314.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
XM_005252312.1      GATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGAC
                    ************************************************************

HsCD00081799        ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
XM_005252315.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
XM_005252313.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
NM_001170415.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
NM_001170416.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
NM_004817.3         ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
XM_005252311.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
XM_005252314.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
XM_005252312.1      ACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGAT
                    ************************************************************

HsCD00081799        ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
XM_005252315.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
XM_005252313.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
NM_001170415.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
NM_001170416.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
NM_004817.3         ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
XM_005252311.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
XM_005252314.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
XM_005252312.1      ATTGCAGGCACAGTTGTCCCAGAGACCAACAAGGAACCCAGATACCAAGAGGACCCCCCA
                    ************************************************************

HsCD00081799        GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
XM_005252315.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
XM_005252313.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
NM_001170415.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
NM_001170416.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
NM_004817.3         GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
XM_005252311.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
XM_005252314.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
XM_005252312.1      GCTCCTCAACCAAAAGCAGCCCCGAGAACTTTTCTTCGTCCTAGTCCTGAAGATGAAGCA
                    ************************************************************

HsCD00081799        ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
XM_005252315.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
XM_005252313.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
NM_001170415.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
NM_001170416.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
NM_004817.3         ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
XM_005252311.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
XM_005252314.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
XM_005252312.1      ATATATGGCCCTAATACCAAAATGGTAAGGTTCAAGAAGGGAGACAGCGTGGGCCTCCGG
                    ************************************************************

HsCD00081799        TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
XM_005252315.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
XM_005252313.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
NM_001170415.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
NM_001170416.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
NM_004817.3         TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
XM_005252311.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
XM_005252314.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
XM_005252312.1      TTGGCTGGTGGCAATGATGTCGGGATATTTGTTGCTGGCATTCAAGAAGGGACCTCGGCG
                    ************************************************************

HsCD00081799        GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
XM_005252315.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
XM_005252313.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
NM_001170415.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
NM_001170416.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
NM_004817.3         GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
XM_005252311.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
XM_005252314.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
XM_005252312.1      GAGCAGGAGGGCCTTCAAGAAGGAGACCAGATTCTGAAGGTGAACACACAGGATTTCAGA
                    ************************************************************

HsCD00081799        GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
XM_005252315.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
XM_005252313.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
NM_001170415.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
NM_001170416.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
NM_004817.3         GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
XM_005252311.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
XM_005252314.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
XM_005252312.1      GGATTAGTGCGGGAGGATGCCGTTCTCTACCTGTTAGAAATCCCTAAAGGTGAAATGGTG
                    ************************************************************

HsCD00081799        ACCATTTTAGCTCAGAGCCGAGCTGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
XM_005252315.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
XM_005252313.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
NM_001170415.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
NM_001170416.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
NM_004817.3         ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
XM_005252311.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
XM_005252314.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
XM_005252312.1      ACCATTTTAGCTCAGAGCCGAGCCGATGTGTATAGAGACATCCTGGCTTGTGGCAGAGGG
                    *********************** ************************************

HsCD00081799        GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
XM_005252315.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
XM_005252313.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
NM_001170415.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
NM_001170416.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
NM_004817.3         GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
XM_005252311.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
XM_005252314.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
XM_005252312.1      GATTCGTTTTTTATAAGAAGCCACTTTGAATGTGAGAAGGAAACTCCACAGAGCCTGGCC
                    ************************************************************

HsCD00081799        TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
XM_005252315.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
XM_005252313.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
NM_001170415.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
NM_001170416.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
NM_004817.3         TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
XM_005252311.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
XM_005252314.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
XM_005252312.1      TTCACCAGAGGGGAGGTCTTCCGAGTGGTAGACACACTGTATGACGGCAAGCTGGGCAAC
                    ************************************************************

HsCD00081799        TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
XM_005252315.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
XM_005252313.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
NM_001170415.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
NM_001170416.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
NM_004817.3         TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
XM_005252311.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
XM_005252314.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
XM_005252312.1      TGGCTGGCTGTGAGGATTGGGAACGAGTTGGAGAAAGGCTTAATCCCCAACAAGAGCAGA
                    ************************************************************

HsCD00081799        GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
XM_005252315.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
XM_005252313.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
NM_001170415.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
NM_001170416.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
NM_004817.3         GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
XM_005252311.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
XM_005252314.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
XM_005252312.1      GCTGAACAAATGGCCAGTGTTCAAAATGCCCAGAGAGACAACGCTGGGGACCGGGCAGAT
                    ************************************************************

HsCD00081799        TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
XM_005252315.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
XM_005252313.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
NM_001170415.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
NM_001170416.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
NM_004817.3         TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
XM_005252311.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
XM_005252314.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
XM_005252312.1      TTCTGGAGAATGCGTGGCCAGAGGTCTGGGGTGAAGAAGAACCTGAGGAAAAGTCGGGAA
                    ************************************************************

HsCD00081799        GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
XM_005252315.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
XM_005252313.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
NM_001170415.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
NM_001170416.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
NM_004817.3         GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
XM_005252311.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
XM_005252314.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
XM_005252312.1      GACCTCACAGCTGTTGTGTCTGTCAGCACCAAGTTCCCAGCTTATGAGAGGGTTTTGCTG
                    ************************************************************

HsCD00081799        CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
XM_005252315.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
XM_005252313.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
NM_001170415.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
NM_001170416.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
NM_004817.3         CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
XM_005252311.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
XM_005252314.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
XM_005252312.1      CGAGAAGCTGGTTTCAAGAGACCTGTGGTCTTATTCGGCCCCATAGCTGATATAGCAATG
                    ************************************************************

HsCD00081799        GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
XM_005252315.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
XM_005252313.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
NM_001170415.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
NM_001170416.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
NM_004817.3         GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
XM_005252311.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
XM_005252314.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
XM_005252312.1      GAAAAATTGGCTAATGAGTTACCTGACTGGTTTCAAACTGCTAAAACGGAACCAAAAGAT
                    ************************************************************

HsCD00081799        GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAG
XM_005252315.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
XM_005252313.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
NM_001170415.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
NM_001170416.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
NM_004817.3         GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
XM_005252311.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
XM_005252314.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
XM_005252312.1      GCAGGATCTGAGAAATCCACTGGAGTGGTCCGGTTAAATACCGTGAGGCAAATTATTGAA
                    ***********************************************************.

HsCD00081799        CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
XM_005252315.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
XM_005252313.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
NM_001170415.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
NM_001170416.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
NM_004817.3         CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
XM_005252311.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
XM_005252314.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
XM_005252312.1      CAGGATAAGCATGCACTACTGGATGTGACTCCGAAAGCTGTGGACCTGTTGAATTACACC
                    ************************************************************

HsCD00081799        CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
XM_005252315.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
XM_005252313.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
NM_001170415.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
NM_001170416.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
NM_004817.3         CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
XM_005252311.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
XM_005252314.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
XM_005252312.1      CAGTGGTTCCCAATTGTGATTTTTTTCAACCCAGACTCCAGACAAGGTGTCAAAACCATG
                    ************************************************************

HsCD00081799        AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
XM_005252315.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
XM_005252313.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
NM_001170415.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
NM_001170416.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
NM_004817.3         AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
XM_005252311.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
XM_005252314.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
XM_005252312.1      AGACAAAGGTTAAATCCAACGTCCAACAAAAGTTCTCGAAAGTTATTTGATCAAGCCAAC
                    ************************************************************

HsCD00081799        AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
XM_005252315.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
XM_005252313.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
NM_001170415.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
NM_001170416.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
NM_004817.3         AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
XM_005252311.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
XM_005252314.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
XM_005252312.1      AAGCTTAAAAAAACGTGTGCACACCTTTTTACAGCTACAATCAACCTAAATTCAGCCAAT
                    ************************************************************

HsCD00081799        GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
XM_005252315.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
XM_005252313.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
NM_001170415.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
NM_001170416.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
NM_004817.3         GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
XM_005252311.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
XM_005252314.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
XM_005252312.1      GATAGCTGGTTTGGCAGCTTAAAGGACACTATTCAGCATCAGCAAGGAGAAGCGGTTTGG
                    ************************************************************

HsCD00081799        GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
XM_005252315.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
XM_005252313.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
NM_001170415.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
NM_001170416.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
NM_004817.3         GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
XM_005252311.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
XM_005252314.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
XM_005252312.1      GTCTCTGAAGGAAAGATGGAAGGGATGGATGATGACCCCGAAGACCGCATGTCCTACTTA
                    ************************************************************

HsCD00081799        ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
XM_005252315.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
XM_005252313.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
NM_001170415.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
NM_001170416.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
NM_004817.3         ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
XM_005252311.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
XM_005252314.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
XM_005252312.1      ACCGCCATGGGCGCGGACTATCTGAGTTGCGACAGCCGCCTCATCAGTGACTTTGAAGAC
                    ************************************************************

HsCD00081799        ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
XM_005252315.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
XM_005252313.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
NM_001170415.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
NM_001170416.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
NM_004817.3         ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
XM_005252311.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
XM_005252314.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
XM_005252312.1      ACGGACGGTGAAGGAGGCGCCTACACTGACAATGAGCTGGATGAGCCAGCCGAGGAGCCG
                    ************************************************************

HsCD00081799        CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAA
XM_005252315.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAG---------------
XM_005252313.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAG---------------
NM_001170415.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGG-----------
NM_001170416.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAA
NM_004817.3         CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAA
XM_005252311.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAA
XM_005252314.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAA
XM_005252312.1      CTGGTGTCGTCCATCACCCGCTCCTCGGAGCCGGTGCAGCACGAGGAGAGCATAAGGAAA
                    *********************************************               

HsCD00081799        CCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGAC
XM_005252315.1      ------------------------------------------------------------
XM_005252313.1      ------------------------------------------------------------
NM_001170415.1      ------------------------------------------------------------
NM_001170416.1      CCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGAC
NM_004817.3         CCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGAC
XM_005252311.1      CCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGAC
XM_005252314.1      CCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGAC
XM_005252312.1      CCCAGCCCAGAGCCACGAGCTCAGATGAGGAGGGCTGCTAGCAGCGATCAACTTAGGGAC
                                                                                

HsCD00081799        AATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAA
XM_005252315.1      ------------------------------------GAG---------------------
XM_005252313.1      ------------------------------------GAGGCCAAAACCCAGAACAAAGAA
NM_001170415.1      ----------------------------------------CCAAAACCCAGAACAAAGAA
NM_001170416.1      AATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAA
NM_004817.3         AATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAA
XM_005252311.1      AATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAA
XM_005252314.1      AATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAA
XM_005252312.1      AATAGCCCGCCCCCAGCATTCAAGCCAGAGCCGCCCAAGGCCAAAACCCAGAACAAAGAA
                                                                                

HsCD00081799        GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
XM_005252315.1      ------------------------------------------------------------
XM_005252313.1      GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
NM_001170415.1      GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
NM_001170416.1      GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
NM_004817.3         GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
XM_005252311.1      GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
XM_005252314.1      GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
XM_005252312.1      GAATCCTATGACTTCTCCAAATCCTATGAATATAAGTCAAACCCCTCTGCCGTTGCTGGT
                                                                                

HsCD00081799        AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
XM_005252315.1      ------------------------------------------------------------
XM_005252313.1      AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
NM_001170415.1      AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
NM_001170416.1      AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
NM_004817.3         AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
XM_005252311.1      AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
XM_005252314.1      AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
XM_005252312.1      AATGAAACTCCTGGGGCATCTACCAAAGGTTATCCTCCTCCTGTTGCAGCAAAACCTACC
                                                                                

HsCD00081799        TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
XM_005252315.1      ------------------------------------------------------------
XM_005252313.1      TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
NM_001170415.1      TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
NM_001170416.1      TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
NM_004817.3         TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
XM_005252311.1      TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
XM_005252314.1      TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
XM_005252312.1      TTTGGGCGGTCTATACTGAAGCCCTCCACTCCCATCCCTCCTCAAGAGGGTGAGGAGGTG
                                                                                

HsCD00081799        GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
XM_005252315.1      ------------------------------------------------------------
XM_005252313.1      GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
NM_001170415.1      GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
NM_001170416.1      GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
NM_004817.3         GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
XM_005252311.1      GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
XM_005252314.1      GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
XM_005252312.1      GGAGAGAGCAGTGAGGAGCAAGATAATGCTCCCAAATCAGTCCTGGGCAAAGTCAAAATA
                                                                                

HsCD00081799        TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
XM_005252315.1      ------------------------------------------------------------
XM_005252313.1      TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
NM_001170415.1      TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
NM_001170416.1      TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
NM_004817.3         TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
XM_005252311.1      TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
XM_005252314.1      TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
XM_005252312.1      TTTGAGAAGATGGATCACAAGGCCAGGTTACAGAGAATGCAGGAGCTCCAGGAAGCACAG
                                                                                

HsCD00081799        AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
XM_005252315.1      ---------ATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
XM_005252313.1      AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
NM_001170415.1      AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
NM_001170416.1      AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
NM_004817.3         AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
XM_005252311.1      AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
XM_005252314.1      AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
XM_005252312.1      AATGCAAGGATCGAAATTGCCCAGAAGCATCCTGATATCTATGCAGTTCCAATCAAAACG
                             ***************************************************

HsCD00081799        CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
XM_005252315.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
XM_005252313.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
NM_001170415.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
NM_001170416.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
NM_004817.3         CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
XM_005252311.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
XM_005252314.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
XM_005252312.1      CACAAGCCAGACCCTGGCACGCCCCAGCACACGAGTTCCAGACCCCCTGAGCCACAGAAA
                    ************************************************************

HsCD00081799        GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
XM_005252315.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
XM_005252313.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
NM_001170415.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
NM_001170416.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
NM_004817.3         GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
XM_005252311.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
XM_005252314.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
XM_005252312.1      GCTCCTTCCAGACCTTATCAGGATACCAGAGGAAGTTATGGCAGTGATGCCGAGGAGGAG
                    ************************************************************

HsCD00081799        GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
XM_005252315.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
XM_005252313.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
NM_001170415.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
NM_001170416.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
NM_004817.3         GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
XM_005252311.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
XM_005252314.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
XM_005252312.1      GAGTACCGCCAGCAGCTGTCAGAACACTCCAAGCGCGGTTACTATGGCCAGTCTGCCCGA
                    ************************************************************

HsCD00081799        TACCGGGACACAGAATTATGA
XM_005252315.1      TACCGGGACACAGAATTATAG
XM_005252313.1      TACCGGGACACAGAATTATAG
NM_001170415.1      TACCGGGACACAGAATTATAG
NM_001170416.1      TACCGGGACACAGAATTATAG
NM_004817.3         TACCGGGACACAGAATTATAG
XM_005252311.1      TACCGGGACACAGAATTATAG
XM_005252314.1      TACCGGGACACAGAATTATAG
XM_005252312.1      TACCGGGACACAGAATTATAG
                    *******************..

Pathways

NCI : Validated targets of C-MYC transcriptional repression
Reactome : Apoptosis
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Signal Transduction
Reactome : Signaling by Hippo

Protein

SMART domain : GuKc : Guanylate kinase homologues.
SMART domain : SH3 : Src homology 3 domains
SMART domain : PDZ : Domain present in PSD-95, Dlg, and ZO-1/2.
UniProt : B7Z2R3
UniProt : Q9UDY2
UniProt : B7Z2R8
UniProt : B7Z954
UniProt : B7Z7T6
HPRD : 06369

Clone

Cloning Information : 266423
HIP Master Clone ID : 198521
IMAGE ID : 100002896
Original Clone ID : FLH266423.01X

Organism


TAX_ID : 9606
Species Specific ID: 9414

Genome

Chromosome : 9
Map Location : 9q13-q21
Ensembl : ENSG00000119139

Reagents

Labome : TJP2-antibody