DNASU Plasmid Repository • 480.965.5697 | Email

PRKAR2B (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKAR2B
Gene Name:  protein kinase, cAMP-dependent, regulatory, type II, beta
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH266441.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00081817

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1257nts         Open reading frame : 1 to 1257
Reference Sequence Alignment

ATGAGCATCGAGATCCCGGCGGGACTGACGGAGCTGCTGCAGGGCTTCACGGTGGAGGTG
CTGAGGCACCAGCCCGCGGACCTGCTGGAGTTCGCTCTGCAGCACTTCACCCGCCTGCAG
CAGGAGAACGAGCGCAAAGGCACCGCGCGCTTCTGCCATGAGGGCAGGACCTGGGGGGAC
CTGGGCGCCGCTGCCGGGGGCGGCACCCCCAGCAAGGGGGTCAACTTCGCCGAGGAGCCC
ATGCAGTCCGACTCCGAGGACGGGGAGGAGGAGGAGGCGGCGCCCGCGGACGCAGGGGCG
TTCAATGCTCCAGTAATAAACCGATTCACAAGGCGTGCCTCAGTATGTGCAGAAGCTTAT
AATCCTGATGAAGAAGAAGATGATGCAGAGTCCAGGATTATACATCCAAAAACTGATGAT
CAAAGAAATAGGTTGCAAGAGGCTTGCAAAGACATCCTGCTGTTTAAGAATCTGGATCCG
GAGCAGATGTCTCAAGTATTAGATGCCATGTTTGAAAAATTGGTCAAAGATGGGGAGCAT
GTAATTGATCAAGGTGACGATGGTGACAACTTTTATGTAATTGATAGAGGCACATTTGAT
ATTTATGTGAAATGTGATGGTGTTGGAAGATGTGTTGGTAACTATGATAATCGTGGGAGT
TTCGGCGAACTGGCCTTAATGTACAATACACCCAGAGCAGCTACAATCACTGCTACCTCT
CCTGGTGCTCTGTGGGGTTTGGACAGGGTAACCTTCAGGAGAATAATTGTGAAAAACAAT
GCCAAAAAGAGAAAAATGTATGAAAGCTTTATTGAGTCACTGCCATTCCTTAAATCTTTG
GAGTTTTCTGAACGCCTGAAAGTAGTAGATGTGATAGGCACCAAAGTATACAACGATGGA
GAACAAATCATTGCTCAGGGAGATTCGGCTGATTCTTTTTTCATTGTAGAATCTGGAGAA
GTGAAAATTACTATGAAAAGAAAGGGTAAATCAGAAGTGGAAGAGAATGGTGCAGTAGAA
ATCGCTCGATGCTCGCGGGGACAGTACTTTGGAGAGCTTGCCCTGGTAACTAACAAACCT
CGAGCAGCTTCTGCCCACGCCATTGGGACTGTCAAATGTTTAGCAATGGATGTGCAAGCA
TTTGAAAGGCTTCTGGGACCTTGCATGGAAATTATGAAAAGGAACATCGCTACCTATGAA
GAACAGTTAGTTGCCCTGTTTGGAACGAACATGGATATTGTTGAACCCACTGCATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1471
Start on reference sequence 215
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
ATCCACCCAGCTTTCTTGTACA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKAR2B
Symbol Nomenclature : PRKAR2B
SYNONYM : PRKAR2; RII-BETA
Designation : H_RG363E19.2|WUGSC:H_RG363E19.2|cAMP-dependent protein kinase type II-beta regulatory chain|cAMP-dependent protein kinase type II-beta regulatory subunit
Full Nomenclature : protein kinase, cAMP-dependent, regulatory, type II, beta
GENEID : 5577
GI : 117644223
GenBank Accession : AM392728
HGNC : 9392
MIM : 176912
Vega : OTTHUMG00000137418
Target GenBank: BC075800

 

Reference Sequence Alignment

  

HsCD00081817      ATGAGCATCGAGATCCCGGCGGGACTGACGGAGCTGCTGCAGGGCTTCACGGTGGAGGTG
NM_002736.2       ATGAGCATCGAGATCCCGGCGGGACTGACGGAGCTGCTGCAGGGCTTCACGGTGGAGGTG
                  ************************************************************

HsCD00081817      CTGAGGCACCAGCCCGCGGACCTGCTGGAGTTCGCTCTGCAGCACTTCACCCGCCTGCAG
NM_002736.2       CTGAGGCACCAGCCCGCGGACCTGCTGGAGTTCGCGCTGCAGCACTTCACCCGCCTGCAG
                  *********************************** ************************

HsCD00081817      CAGGAGAACGAGCGCAAAGGCACCGCGCGCTTCTGCCATGAGGGCAGGACCTGGGGGGAC
NM_002736.2       CAGGAGAACGAGCGCAAAGGCACCGCGCGCTTCGGCCATGAGGGCAGGACCTGGGGGGAC
                  ********************************* **************************

HsCD00081817      CTGGGCGCCGCTGCCGGGGGCGGCACCCCCAGCAAGGGGGTCAACTTCGCCGAGGAGCCC
NM_002736.2       CTGGGCGCCGCTGCCGGGGGCGGCACCCCCAGCAAGGGGGTCAACTTCGCCGAGGAGCCC
                  ************************************************************

HsCD00081817      ATGCAGTCCGACTCCGAGGACGGGGAGGAGGAGGAGGCGGCGCCCGCGGACGCAGGGGCG
NM_002736.2       ATGCAGTCCGACTCCGAGGACGGGGAGGAGGAGGAGGCGGCGCCCGCGGACGCAGGGGCG
                  ************************************************************

HsCD00081817      TTCAATGCTCCAGTAATAAACCGATTCACAAGGCGTGCCTCAGTATGTGCAGAAGCTTAT
NM_002736.2       TTCAATGCTCCAGTAATAAACCGATTCACAAGGCGTGCCTCAGTATGTGCAGAAGCTTAT
                  ************************************************************

HsCD00081817      AATCCTGATGAAGAAGAAGATGATGCAGAGTCCAGGATTATACATCCAAAAACTGATGAT
NM_002736.2       AATCCTGATGAAGAAGAAGATGATGCAGAGTCCAGGATTATACATCCAAAAACTGATGAT
                  ************************************************************

HsCD00081817      CAAAGAAATAGGTTGCAAGAGGCTTGCAAAGACATCCTGCTGTTTAAGAATCTGGATCCG
NM_002736.2       CAAAGAAATAGGTTGCAAGAGGCTTGCAAAGACATCCTGCTGTTTAAGAATCTGGATCCG
                  ************************************************************

HsCD00081817      GAGCAGATGTCTCAAGTATTAGATGCCATGTTTGAAAAATTGGTCAAAGATGGGGAGCAT
NM_002736.2       GAGCAGATGTCTCAAGTATTAGATGCCATGTTTGAAAAATTGGTCAAAGATGGGGAGCAT
                  ************************************************************

HsCD00081817      GTAATTGATCAAGGTGACGATGGTGACAACTTTTATGTAATTGATAGAGGCACATTTGAT
NM_002736.2       GTAATTGATCAAGGTGACGATGGTGACAACTTTTATGTAATTGATAGAGGCACATTTGAT
                  ************************************************************

HsCD00081817      ATTTATGTGAAATGTGATGGTGTTGGAAGATGTGTTGGTAACTATGATAATCGTGGGAGT
NM_002736.2       ATTTATGTGAAATGTGATGGTGTTGGAAGATGTGTTGGTAACTATGATAATCGTGGGAGT
                  ************************************************************

HsCD00081817      TTCGGCGAACTGGCCTTAATGTACAATACACCCAGAGCAGCTACAATCACTGCTACCTCT
NM_002736.2       TTCGGCGAACTGGCCTTAATGTACAATACACCCAGAGCAGCTACAATCACTGCTACCTCT
                  ************************************************************

HsCD00081817      CCTGGTGCTCTGTGGGGTTTGGACAGGGTAACCTTCAGGAGAATAATTGTGAAAAACAAT
NM_002736.2       CCTGGTGCTCTGTGGGGTTTGGACAGGGTAACCTTCAGGAGAATAATTGTGAAAAACAAT
                  ************************************************************

HsCD00081817      GCCAAAAAGAGAAAAATGTATGAAAGCTTTATTGAGTCACTGCCATTCCTTAAATCTTTG
NM_002736.2       GCCAAAAAGAGAAAAATGTATGAAAGCTTTATTGAGTCACTGCCATTCCTTAAATCTTTG
                  ************************************************************

HsCD00081817      GAGTTTTCTGAACGCCTGAAAGTAGTAGATGTGATAGGCACCAAAGTATACAACGATGGA
NM_002736.2       GAGTTTTCTGAACGCCTGAAAGTAGTAGATGTGATAGGCACCAAAGTATACAACGATGGA
                  ************************************************************

HsCD00081817      GAACAAATCATTGCTCAGGGAGATTCGGCTGATTCTTTTTTCATTGTAGAATCTGGAGAA
NM_002736.2       GAACAAATCATTGCTCAGGGAGATTCGGCTGATTCTTTTTTCATTGTAGAATCTGGAGAA
                  ************************************************************

HsCD00081817      GTGAAAATTACTATGAAAAGAAAGGGTAAATCAGAAGTGGAAGAGAATGGTGCAGTAGAA
NM_002736.2       GTGAAAATTACTATGAAAAGAAAGGGTAAATCAGAAGTGGAAGAGAATGGTGCAGTAGAA
                  ************************************************************

HsCD00081817      ATCGCTCGATGCTCGCGGGGACAGTACTTTGGAGAGCTTGCCCTGGTAACTAACAAACCT
NM_002736.2       ATCGCTCGATGCTCGCGGGGACAGTACTTTGGAGAGCTTGCCCTGGTAACTAACAAACCT
                  ************************************************************

HsCD00081817      CGAGCAGCTTCTGCCCACGCCATTGGGACTGTCAAATGTTTAGCAATGGATGTGCAAGCA
NM_002736.2       CGAGCAGCTTCTGCCCACGCCATTGGGACTGTCAAATGTTTAGCAATGGATGTGCAAGCA
                  ************************************************************

HsCD00081817      TTTGAAAGGCTTCTGGGACCTTGCATGGAAATTATGAAAAGGAACATCGCTACCTATGAA
NM_002736.2       TTTGAAAGGCTTCTGGGACCTTGCATGGAAATTATGAAAAGGAACATCGCTACCTATGAA
                  ************************************************************

HsCD00081817      GAACAGTTAGTTGCCCTGTTTGGAACGAACATGGATATTGTTGAACCCACTGCATGA
NM_002736.2       GAACAGTTAGTTGCCCTGTTTGGAACGAACATGGATATTGTTGAACCCACTGCATGA
                  *********************************************************

Pathways

Panther : 5HT1 type receptor mediated signaling pathway
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Endothelin signaling pathway
Panther : Enkephalin release
Panther : GABA-B receptor II signaling
Panther : Hedgehog signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Histamine H2 receptor mediated signaling pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Transcription regulation by bZIP transcription factor
Reactome : Aquaporin-mediated transport
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DARPP-32 events
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G-protein mediated events
Reactome : G2/M Transition
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : Metabolism
Reactome : Mitotic G2-G2/M phases
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Opioid Signalling
Reactome : PKA activation
Reactome : PKA activation in glucagon signalling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transmembrane transport of small molecules
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : G Protein Signaling Pathways
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 266441
HIP Master Clone ID : 198539
IMAGE ID : 100002941
Original Clone ID : FLH266441.01X

Organism


TAX_ID : 9606
Species Specific ID: 5577

Genome

Chromosome : 7
Map Location : 7q22
Ensembl : ENSG00000005249

Reagents

Labome : PRKAR2B-antibody