DNASU Plasmid Repository • 480.965.5697 | Email

NCOA7 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NCOA7
Gene Name:  nuclear receptor coactivator 7
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH266552.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
HsCD00081928

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2829nts        
Open reading frame : 1 to 2829
Reference Sequence Alignment

ATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAG
AAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAGGACTCATACT
GGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACATTGCTGTGGAA
GAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAACAAAACACATGATAAA
AAAGAGAAGAAGATGGTGGTTCAGAAGCCCCATGGGATTATGGAATACACTGCTGGAAAC
CAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTGGTGGAA
CTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAGGTCCTTTTTGTGCCAGATGCC
AACTCTCCTTCCAGTACCTTAAGGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCT
TCATCATCAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGAAAGGCCTTG
AAACCCATTGAAAGAGTCTTATCGTCTACTTCTGAAGAAGATGAGCCAGGTGTGGTGAAA
TTTTTAAAAATGAATTGTCGATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATG
ATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCTCTGGTTATTGAA
AATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAAGAGGTTGTTTCCATTGCGCTC
TACAATGACATTTCTCACATGAAGATCAAAGATGCCTTGCCATCTGACCTACCTCAGGAT
CTTTGTCCTCTGTACAGGCCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGGTATCAAC
CCATTCAGTAAGTTCAAATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATT
ATGACTTCGGATTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACACCTACA
AAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAAACTGGACTCCCCTAGGGAGACA
TCCCATGGTTCTCCCACAGTGACTAAGCTCAGCAAGGAACCTTCCGACACTTCTGCTGCA
TTTGAATCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGTTGACTTGGAA
GAACTTTCTTCTCAAACTGGTGGTGGAATGCACAAAAAAGACACCTTGAAGGAGTGCCTT
TCTCTTGACCCAGAGGAACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGAA
ATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAATGATGTTGAACTGAAGGGG
GCGCTAGATTTAGAAACCTGTGAGAAGCAAGATATAATGCCAGAAATGGACAAGCAGTCT
GGTTCGCCAGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTAGATAAAGTT
AAACTCATTGAATATTACCTGACTAAGAACAAAGAAGGGCCACAGGTATCTGAAAATTTG
CAGAAAACAGAATTAAGTGATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTT
AGTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAG
ACCTGGGTGAAAAAGGGAGAACCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAAT
GTGATTAAAGAGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGT
GCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCTGTTAAAGAGAGTTCAGGTACCC
ATTGAAGATATACTTCCTTCAAAAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGC
ATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCAGCCATGGTCCAG
CAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCTCGGGAGAGGGTG
GATCATTTGTACACATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCAAA
GAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACATGATTGACAACTTCTTCAGT
GAGCCAACAACCAAGAGCTGGGAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGC
ACATGCAGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGC
GCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGACGCCTTCCTGCAAGGGTGCAA
GGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGCTC
TACCGGAAATCGGCATCACTAGGCAGTCCTGTCCTATTGGTCATCAAAGATATGGATAAT
CAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACA
GGCGAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAA
AATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGA
TTTGGTTTATGGCTAGACGCTGATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTC
AATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGTGTGGGCA
TTTGATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3181
Start on reference sequence 353
Mutations:
None
Discrepancy:
c338t,T113I; g529a,A177T;
 g746t,C249F; c833t,T278I
                                

5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
CTTGACCCAGCTTTCTTGTACA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NCOA7
Symbol Nomenclature : NCOA7
SYNONYM : ERAP140; ESNA1; Nbla00052; Nbla10993; TLDC4; dJ187J11.3
Designation : 140 kDa estrogen receptor-associated protein|TBC/LysM-associated domain containing 4|estrogen nuclear receptor coactivator 1|estrogen receptor associated protein 140 kDa|putative protein product of Nbla00052|putative protein product of Nbla10993
Full Nomenclature : nuclear receptor coactivator 7
GENEID : 135112
Locus Tag : RP1-187J11.1
GI : 117644555
GenBank Accession : AM392895
HGNC : 21081
MIM : 609752
Vega : OTTHUMG00000015513
Target GenBank: NM_181782

 

Reference Sequence Alignment

  

HsCD00081928        ATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAG
NM_001199620.1      ATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAG
NM_001199619.1      ATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAG
NM_001122842.2      ATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAG
NM_181782.4         ATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAG
                    ************************************************************

HsCD00081928        AAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAGGACTCATACT
NM_001199620.1      AAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAGGACTCATACT
NM_001199619.1      AAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAGGACTCATACT
NM_001122842.2      AAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAGGACTCATACT
NM_181782.4         AAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAGGACTCATACT
                    ************************************************************

HsCD00081928        GGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACATTGCTGTGGAA
NM_001199620.1      GGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACATTGCTGTGGAA
NM_001199619.1      GGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACATTGCTGTGGAA
NM_001122842.2      GGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACATTGCTGTGGAA
NM_181782.4         GGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACATTGCTGTGGAA
                    ************************************************************

HsCD00081928        GAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
NM_001199620.1      GAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
NM_001199619.1      GAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
NM_001122842.2      GAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
NM_181782.4         GAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
                    ************************************************************

HsCD00081928        CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAACAAAACACATGATAAA
NM_001199620.1      CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAACAAAACACATGATAAA
NM_001199619.1      CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAACAAAACACATGATAAA
NM_001122842.2      CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAACAAAACACATGATAAA
NM_181782.4         CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAACAAAACACATGATAAA
                    ************************************************************

HsCD00081928        AAAGAGAAGAAGATGGTGGTTCAGAAGCCCCATGGGATTATGGAATACACTGCTGGAAAC
NM_001199620.1      AAAGAGAAGAAGATGGTGGTTCAGAAGCCCCATGGGACTATGGAATACACTGCTGGAAAC
NM_001199619.1      AAAGAGAAGAAGATGGTGGTTCAGAAGCCCCATGGGACTATGGAATACACTGCTGGAAAC
NM_001122842.2      AAAGAGAAGAAGATGGTGGTTCAGAAGCCCCATGGGACTATGGAATACACTGCTGGAAAC
NM_181782.4         AAAGAGAAGAAGATGGTGGTTCAGAAGCCCCATGGGACTATGGAATACACTGCTGGAAAC
                    ************************************* **********************

HsCD00081928        CAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTGGTGGAA
NM_001199620.1      CAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTGGTGGAA
NM_001199619.1      CAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTGGTGGAA
NM_001122842.2      CAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTGGTGGAA
NM_181782.4         CAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTGGTGGAA
                    ************************************************************

HsCD00081928        CTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAGGTCCTTTTTGTGCCAGATGCC
NM_001199620.1      CTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAGGTCCTTTTTGTGCCAGATGCC
NM_001199619.1      CTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAGGTCCTTTTTGTGCCAGATGCC
NM_001122842.2      CTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAGGTCCTTTTTGTGCCAGATGCC
NM_181782.4         CTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAGGTCCTTTTTGTGCCAGATGCC
                    ************************************************************

HsCD00081928        AACTCTCCTTCCAGTACCTTAAGGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCT
NM_001199620.1      AACTCTCCTTCCAGTACCTTAAGGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCT
NM_001199619.1      AACTCTCCTTCCAGTACCTTAAGGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCT
NM_001122842.2      AACTCTCCTTCCAGTACCTTAAGGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCT
NM_181782.4         AACTCTCCTTCCAGTACCTTAAGGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCT
                    ************************************************************

HsCD00081928        TCATCATCAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGAAAGGCCTTG
NM_001199620.1      TCATCATCAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGAAAGGCCTTG
NM_001199619.1      TCATCATCAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGAAAGGCCTTG
NM_001122842.2      TCATCATCAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGAAAGGCCTTG
NM_181782.4         TCATCATCAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGAAAGGCCTTG
                    ************************************************************

HsCD00081928        AAACCCATTGAAAGAGTCTTATCGTCTACTTCTGAAGAAGATGAGCCAGGTGTGGTGAAA
NM_001199620.1      AAACCCATTGAAAGAGTCTTATCGTCTACTTCTGAAGAAGATGAGCCAGGTGTGGTGAAA
NM_001199619.1      AAACCCATTGAAAGAGTCTTATCGTCTACTTCTGAAGAAGATGAGCCAGGTGTGGTGAAA
NM_001122842.2      AAACCCATTGAAAGAGTCTTATCGTCTACTTCTGAAGAAGATGAGCCAGGTGTGGTGAAA
NM_181782.4         AAACCCATTGAAAGAGTCTTATCGTCTACTTCTGAAGAAGATGAGCCAGGTGTGGTGAAA
                    ************************************************************

HsCD00081928        TTTTTAAAAATGAATTGTCGATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATG
NM_001199620.1      TTTTTAAAAATGAATTGTCGATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATG
NM_001199619.1      TTTTTAAAAATGAATTGTCGATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATG
NM_001122842.2      TTTTTAAAAATGAATTGTCGATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATG
NM_181782.4         TTTTTAAAAATGAATTGTCGATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATG
                    ************************************************************

HsCD00081928        ATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCTCTGGTTATTGAA
NM_001199620.1      ATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCTCTGGTTATTGAA
NM_001199619.1      ATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCTCTGGTTATTGAA
NM_001122842.2      ATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCTCTGGTTATTGAA
NM_181782.4         ATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCTCTGGTTATTGAA
                    ************************************************************

HsCD00081928        AATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAAGAGGTTGTTTCCATTGCGCTC
NM_001199620.1      AATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAAGAGGTTGTTTCCATTGCGCTC
NM_001199619.1      AATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAAGAGGTTGTTTCCATTGCGCTC
NM_001122842.2      AATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAAGAGGTTGTTTCCATTGCGCTC
NM_181782.4         AATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAAGAGGTTGTTTCCATTGCGCTC
                    ************************************************************

HsCD00081928        TACAATGACATTTCTCACATGAAGATCAAAGATGCCTTGCCATCTGACCTACCTCAGGAT
NM_001199620.1      TACAATGACATTTCTCACATGAAGATCAAAGATGCCTTGCCATCTGACCTACCTCAGGAT
NM_001199619.1      TACAATGACATTTCTCACATGAAGATCAAAGATGCCTTGCCATCTGACCTACCTCAGGAT
NM_001122842.2      TACAATGACATTTCTCACATGAAGATCAAAGATGCCTTGCCATCG---------------
NM_181782.4         TACAATGACATTTCTCACATGAAGATCAAAGATGCCTTGCCATCTGACCTACCTCAGGAT
                    ********************************************                

HsCD00081928        CTTTGTCCTCTGTACAGGCCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGGTATCAAC
NM_001199620.1      CTTTGTCCTCTGTACAGGCCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGATATCAAC
NM_001199619.1      CTTTGTCCTCTGTACAGGCCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGATATCAAC
NM_001122842.2      ------------------CCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGATATCAAC
NM_181782.4         CTTTGTCCTCTGTACAGGCCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGATATCAAC
                                      **********************************.*******

HsCD00081928        CCATTCAGTAAGTTCAAATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATT
NM_001199620.1      CCATTCAGTAAGTTCAAATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATT
NM_001199619.1      CCATTCAGTAAGTTCAAATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATT
NM_001122842.2      CCATTCAGTAAGTTCAAATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATT
NM_181782.4         CCATTCAGTAAGTTCAAATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATT
                    ************************************************************

HsCD00081928        ATGACTTCGGATTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACACCTACA
NM_001199620.1      ATGACTTCGGATTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACACCTACA
NM_001199619.1      ATGACTTCGGATTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACACCTACA
NM_001122842.2      ATGACTTCGGATTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACACCTACA
NM_181782.4         ATGACTTCGGATTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACACCTACA
                    ************************************************************

HsCD00081928        AAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAAACTGGACTCCCCTAGGGAGACA
NM_001199620.1      AAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAAACTGGACTCCTCTAGGGAGACA
NM_001199619.1      AAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAAACTGGACTCCTCTAGGGAGACA
NM_001122842.2      AAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAAACTGGACTCCTCTAGGGAGACA
NM_181782.4         AAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAAACTGGACTCCTCTAGGGAGACA
                    ************************************************ ***********

HsCD00081928        TCCCATGGTTCTCCCACAGTGACTAAGCTCAGCAAGGAACCTTCCGACACTTCTGCTGCA
NM_001199620.1      TCCCATGGTTCTCCCACAGTGACTAAGCTCAGCAAGGAACCTTCCGACACTTCTTCTGCA
NM_001199619.1      TCCCATGGTTCTCCCACAGTGACTAAGCTCAGCAAGGAACCTTCCGACACTTCTTCTGCA
NM_001122842.2      TCCCATGGTTCTCCCACAGTGACTAAGCTCAGCAAGGAACCTTCCGACACTTCTTCTGCA
NM_181782.4         TCCCATGGTTCTCCCACAGTGACTAAGCTCAGCAAGGAACCTTCCGACACTTCTTCTGCA
                    ****************************************************** *****

HsCD00081928        TTTGAATCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGTTGACTTGGAA
NM_001199620.1      TTTGAATCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGTTGACTTGGAA
NM_001199619.1      TTTGAATCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGTTGACTTGGAA
NM_001122842.2      TTTGAATCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGTTGACTTGGAA
NM_181782.4         TTTGAATCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGTTGACTTGGAA
                    ************************************************************

HsCD00081928        GAACTTTCTTCTCAAACTGGTGGTGGAATGCACAAAAAAGACACCTTGAAGGAGTGCCTT
NM_001199620.1      GAACTTTCTTCTCAAACTGGTGGTGGAATGCACAAAAAAGACACCTTGAAGGAGTGCCTT
NM_001199619.1      GAACTTTCTTCTCAAACTGGTGGTGGAATGCACAAAAAAGACACCTTGAAGGAGTGCCTT
NM_001122842.2      GAACTTTCTTCTCAAACTGGTGGTGGAATGCACAAAAAAGACACCTTGAAGGAGTGCCTT
NM_181782.4         GAACTTTCTTCTCAAACTGGTGGTGGAATGCACAAAAAAGACACCTTGAAGGAGTGCCTT
                    ************************************************************

HsCD00081928        TCTCTTGACCCAGAGGAACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGAA
NM_001199620.1      TCTCTTGACCCAGAGGAACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGAA
NM_001199619.1      TCTCTTGACCCAGAGGAACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGAA
NM_001122842.2      TCTCTTGACCCAGAGGAACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGAA
NM_181782.4         TCTCTTGACCCAGAGGAACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGAA
                    ************************************************************

HsCD00081928        ATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAATGATGTTGAACTGAAGGGG
NM_001199620.1      ATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAATGATGTTGAACTGAAGGGG
NM_001199619.1      ATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAATGATGTTGAACTGAAGGGG
NM_001122842.2      ATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAATGATGTTGAACTGAAGGGG
NM_181782.4         ATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAATGATGTTGAACTGAAGGGG
                    ************************************************************

HsCD00081928        GCGCTAGATTTAGAAACCTGTGAGAAGCAAGATATAATGCCAGAAATGGACAAGCAGTCT
NM_001199620.1      GCGCTAGATTTAGAAACCTGTGAGAAGCAAGATATAATGCCAGAAGTGGACAAGCAGTCT
NM_001199619.1      GCGCTAGATTTAGAAACCTGTGAGAAGCAAGATATAATGCCAGAAGTGGACAAGCAGTCT
NM_001122842.2      GCGCTAGATTTAGAAACCTGTGAGAAGCAAGATATAATGCCAGAAGTGGACAAGCAGTCT
NM_181782.4         GCGCTAGATTTAGAAACCTGTGAGAAGCAAGATATAATGCCAGAAGTGGACAAGCAGTCT
                    *********************************************.**************

HsCD00081928        GGTTCGCCAGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTAGATAAAGTT
NM_001199620.1      GGTTCGCCAGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTAGATAAAGTT
NM_001199619.1      GGTTCGCCAGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTAGATAAAGTT
NM_001122842.2      GGTTCGCCAGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTAGATAAAGTT
NM_181782.4         GGTTCGCCAGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTAGATAAAGTT
                    ************************************************************

HsCD00081928        AAACTCATTGAATATTACCTGACTAAGAACAAAGAAGGGCCACAGGTATCTGAAAATTTG
NM_001199620.1      AAACTCATTGAATATTACCTGACTAAGAACAAAGAAGGGCCACAGGTATCTGAAAATTTG
NM_001199619.1      AAACTCATTGAATATTACCTGACTAAGAACAAAGAAGGGCCACAGGTATCTGAAAATTTG
NM_001122842.2      AAACTCATTGAATATTACCTGACTAAGAACAAAGAAGGGCCACAGGTATCTGAAAATTTG
NM_181782.4         AAACTCATTGAATATTACCTGACTAAGAACAAAGAAGGGCCACAGGTATCTGAAAATTTG
                    ************************************************************

HsCD00081928        CAGAAAACAGAATTAAGTGATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTT
NM_001199620.1      CAGAAAACAGAATTAAGTGATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTT
NM_001199619.1      CAGAAAACAGAATTAAGTGATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTT
NM_001122842.2      CAGAAAACAGAATTAAGTGATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTT
NM_181782.4         CAGAAAACAGAATTAAGTGATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTT
                    ************************************************************

HsCD00081928        AGTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAG
NM_001199620.1      AGTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAG
NM_001199619.1      AGTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAG
NM_001122842.2      AGTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAG
NM_181782.4         AGTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAG
                    ************************************************************

HsCD00081928        ACCTGGGTGAAAAAGGGAGAACCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAAT
NM_001199620.1      ACCTGGGTGAAAAAGGGAGAGCCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAAT
NM_001199619.1      ACCTGGGTGAAAAAGGGAGAGCCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAAT
NM_001122842.2      ACCTGGGTGAAAAAGGGAGAGCCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAAT
NM_181782.4         ACCTGGGTGAAAAAGGGAGAGCCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAAT
                    ********************.***************************************

HsCD00081928        GTGATTAAAGAGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGT
NM_001199620.1      GTGATTAAAGAGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGT
NM_001199619.1      GTGATTAAAGAGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGT
NM_001122842.2      GTGATTAAAGAGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGT
NM_181782.4         GTGATTAAAGAGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGT
                    ************************************************************

HsCD00081928        GCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCTGTTAAAGAGAGTTCAGGTACCC
NM_001199620.1      GCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCTGTTAAAGAGAATTCAGGTACCC
NM_001199619.1      GCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCTGTTAAAGAGAATTCAGGTACCC
NM_001122842.2      GCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCTGTTAAAGAGAATTCAGGTACCC
NM_181782.4         GCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCTGTTAAAGAGAATTCAGGTACCC
                    ************************************************.***********

HsCD00081928        ATTGAAGATATACTTCCTTCAAAAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGC
NM_001199620.1      ATTGAAGATATACTTCCTTCAAAAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGC
NM_001199619.1      ATTGAAGATATACTTCCTTCAAAAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGC
NM_001122842.2      ATTGAAGATATACTTCCTTCAAAAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGC
NM_181782.4         ATTGAAGATATACTTCCTTCAAAAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGC
                    ************************************************************

HsCD00081928        ATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCAGCCATGGTCCAG
NM_001199620.1      ATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCAGCCATGGTCCAG
NM_001199619.1      ATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCAGCCATGGTCCAG
NM_001122842.2      ATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCAGCCATGGTCCAG
NM_181782.4         ATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCAGCCATGGTCCAG
                    ************************************************************

HsCD00081928        CAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCTCGGGAGAGGGTG
NM_001199620.1      CAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCTCGGGAGAGGGTG
NM_001199619.1      CAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCTCGGGAGAGGGTG
NM_001122842.2      CAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCTCGGGAGAGGGTG
NM_181782.4         CAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCTCGGGAGAGGGTG
                    ************************************************************

HsCD00081928        GATCATTTGTACACATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCAAA
NM_001199620.1      GATCATTTGTACACATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCAAA
NM_001199619.1      GATCATTTGTACACATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCAAA
NM_001122842.2      GATCATTTGTACACATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCAAA
NM_181782.4         GATCATTTGTACACATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCAAA
                    ************************************************************

HsCD00081928        GAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACATGATTGACAACTTCTTCAGT
NM_001199620.1      GAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACATGATTGACAACTTCTTCAGT
NM_001199619.1      GAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACATGATTGACAACTTCTTCAGT
NM_001122842.2      GAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACATGATTGACAACTTCTTCAGT
NM_181782.4         GAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACATGATTGACAACTTCTTCAGT
                    ************************************************************

HsCD00081928        GAGCCAACAACCAAGAGCTGGGAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGC
NM_001199620.1      GAGCCAACAACCAAGAGCTGGGAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGC
NM_001199619.1      GAGCCAACAACCAAGAGCTGGGAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGC
NM_001122842.2      GAGCCAACAACCAAGAGCTGGGAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGC
NM_181782.4         GAGCCAACAACCAAGAGCTGGGAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGC
                    ************************************************************

HsCD00081928        ACATGCAGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGC
NM_001199620.1      ACATGCAGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGC
NM_001199619.1      ACATGCAGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGC
NM_001122842.2      ACATGCAGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGC
NM_181782.4         ACATGCAGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGC
                    ************************************************************

HsCD00081928        GCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGACGCCTTCCTGCAAGGGTGCAA
NM_001199620.1      GCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGACGCCTTCCTGCAAGGGTGCAA
NM_001199619.1      GCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGACGCCTTCCTGCAAGGGTGCAA
NM_001122842.2      GCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGACGCCTTCCTGCAAGGGTGCAA
NM_181782.4         GCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGACGCCTTCCTGCAAGGGTGCAA
                    ************************************************************

HsCD00081928        GGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGCTC
NM_001199620.1      GGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGCTC
NM_001199619.1      GGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGCTC
NM_001122842.2      GGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGCTC
NM_181782.4         GGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGCTC
                    ************************************************************

HsCD00081928        TACCGGAAATCGGCATCACTAGGCAGTCCTGTCCTATTGGTCATCAAAGATATGGATAAT
NM_001199620.1      TACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTCATCAAAGATATGGATAAT
NM_001199619.1      TACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTCATCAAAGATATGGATAAT
NM_001122842.2      TACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTCATCAAAGATATGGATAAT
NM_181782.4         TACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTCATCAAAGATATGGATAAT
                    **********************.*************************************

HsCD00081928        CAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACA
NM_001199620.1      CAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACA
NM_001199619.1      CAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACA
NM_001122842.2      CAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACA
NM_181782.4         CAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACA
                    ************************************************************

HsCD00081928        GGCGAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAA
NM_001199620.1      GGCGAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAA
NM_001199619.1      GGCGAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAA
NM_001122842.2      GGCGAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAA
NM_181782.4         GGCGAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAA
                    ************************************************************

HsCD00081928        AATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGA
NM_001199620.1      AATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGA
NM_001199619.1      AATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGA
NM_001122842.2      AATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGA
NM_181782.4         AATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGA
                    ************************************************************

HsCD00081928        TTTGGTTTATGGCTAGACGCTGATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTC
NM_001199620.1      TTTGGTTTATGGCTAGATGCTGATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTC
NM_001199619.1      TTTGGTTTATGGCTAGATGCTGATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTC
NM_001122842.2      TTTGGTTTATGGCTAGATGCTGATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTC
NM_181782.4         TTTGGTTTATGGCTAGATGCTGATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTC
                    ***************** ******************************************

HsCD00081928        AATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGTGTGGGCA
NM_001199620.1      AATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGTGTGGGCA
NM_001199619.1      AATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGTGTGGGCA
NM_001122842.2      AATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGTGTGGGCA
NM_181782.4         AATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGTGTGGGCA
                    ************************************************************

HsCD00081928        TTTGATTAG
NM_001199620.1      TTTGATTGA
NM_001199619.1      TTTGATTGA
NM_001122842.2      TTTGATTGA
NM_181782.4         TTTGATTGA
                    *******..

Pathways

NCI : Validated nuclear estrogen receptor alpha network

Protein

SMART domain : LysM : Lysin motif
SMART domain : TLDc : domain in TBC and LysM domain containing proteins
UniProt : Q8NI08
UniProt : B7Z2C4
UniProt : Q8N3C8
UniProt : B3KXK4
HPRD : 14814

Clone

Cloning Information : 266552
HIP Master Clone ID : 198650
IMAGE ID : 100002981
Original Clone ID : FLH266552.01X

Organism


TAX_ID : 9606
Species Specific ID: 135112

Genome

Chromosome : 6
Map Location : 6q22.32
Ensembl : ENSG00000111912

Reagents

Labome : NCOA7-antibody