DNASU Plasmid Repository • 480.965.5697 | Email

SNAP25 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SNAP25
Gene Name:  synaptosomal-associated protein, 25kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH266575.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00081951

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 621nts         Open reading frame : 1 to 621
Reference Sequence Alignment

ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAG
TTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAA
GATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTC
GAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGAT
TTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCT
TACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTA
GTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGAT
GCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTC
CGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGG
ATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACA
AAGATGCTGGGAAGTGGTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 753
Start on reference sequence 133
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcaggctCCACC

3' Linker Sequence:
CTTGACCCAGCTTTCTTGTACA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SNAP25
Symbol Nomenclature : SNAP25
SYNONYM : RIC-4; RIC4; SEC9; SNAP; SNAP-25; bA416N4.2; dJ1068F16.2
Designation : SUP|resistance to inhibitors of cholinesterase 4 homolog|super protein|synaptosomal-associated protein 25
Full Nomenclature : synaptosomal-associated protein, 25kDa
GENEID : 6616
GI : 117646123
GenBank Accession : AM393653
HGNC : 11132
MIM : 600322
Vega : OTTHUMG00000031863
Target GenBank: BC010647

 

Reference Sequence Alignment

  

HsCD00081951      ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAG
NM_003081.3       ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAG
NM_130811.2       ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAG
                  ************************************************************

HsCD00081951      TTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAA
NM_003081.3       TTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAA
NM_130811.2       TTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAA
                  ************************************************************

HsCD00081951      GATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTC
NM_003081.3       GATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTC
NM_130811.2       GATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTGGAACGCATT
                  ************************************************** **:** .* 

HsCD00081951      GAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGAT
NM_003081.3       GAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGAT
NM_130811.2       GAGGAAGGGATGGACCAAATCAATAAGGACATGAAAGAAGCAGAAAAGAATTTGACGGAC
                  **.***** ***.****:***** .*.********.**.**:**.**.*****.*..** 

HsCD00081951      TTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCT
NM_003081.3       TTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCT
NM_130811.2       CTAGGAAAATTCTGCGGGCTTTGTGTGTGTCCCTGTAACAAGCTTAAATCAAGTGATGCT
                   ****.**** *** ** ****  .*.***** ***************************

HsCD00081951      TACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTA
NM_003081.3       TACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTA
NM_130811.2       TACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTA
                  ************************************************************

HsCD00081951      GTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGAT
NM_003081.3       GTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGAT
NM_130811.2       GTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGAT
                  ************************************************************

HsCD00081951      GCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTC
NM_003081.3       GCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTC
NM_130811.2       GCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTC
                  ************************************************************

HsCD00081951      CGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGG
NM_003081.3       CGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGG
NM_130811.2       CGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGG
                  ************************************************************

HsCD00081951      ATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACA
NM_003081.3       ATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACA
NM_130811.2       ATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACA
                  ************************************************************

HsCD00081951      AAGATGCTGGGAAGTGGTTAG
NM_003081.3       AAGATGCTGGGAAGTGGTTAA
NM_130811.2       AAGATGCTGGGAAGTGGTTAA
                  ********************.

Pathways

NCI : Effects of Botulinum toxin
Panther : 5HT1 type receptor mediated signaling pathway
Panther : 5HT2 type receptor mediated signaling pathway
Panther : 5HT3 type receptor mediated signaling pathway
Panther : 5HT4 type receptor mediated signaling pathway
Panther : Adrenaline and noradrenaline biosynthesis
Panther : Alpha adrenergic receptor signaling pathway
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Beta3 adrenergic receptor signaling pathway
Panther : Cortocotropin releasing factor receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Ionotropic glutamate receptor pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Panther : Opioid prodynorphin pathway
Panther : Opioid proenkephalin pathway
Panther : Opioid proopiomelanocortin pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Synaptic vesicle trafficking
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Reactome : Acetylcholine Neurotransmitter Release Cycle
Reactome : Disease
Reactome : Dopamine Neurotransmitter Release Cycle
Reactome : GABA synthesis, release, reuptake and degradation
Reactome : Glutamate Neurotransmitter Release Cycle
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : Neuronal System
Reactome : Neurotoxicity of clostridium toxins
Reactome : Neurotransmitter Release Cycle
Reactome : Norepinephrine Neurotransmitter Release Cycle
Reactome : Regulation of insulin secretion
Reactome : Serotonin Neurotransmitter Release Cycle
Reactome : Toxicity of botulinum toxin type A (BoNT/A)
Reactome : Toxicity of botulinum toxin type C (BoNT/C)
Reactome : Toxicity of botulinum toxin type E (BoNT/E)
Reactome : Transmission across Chemical Synapses
WikiPathway : Insulin Signaling

Protein

SMART domain : t_SNARE : Helical region found in SNAREs
UniProt : P60880
HPRD : 02637

Clone

Cloning Information : 266575
HIP Master Clone ID : 198673
IMAGE ID : 100003023
Original Clone ID : FLH266575.01X

Organism


TAX_ID : 9606
Species Specific ID: 6616

Genome

Chromosome : 20
Map Location : 20p12-p11.2
Ensembl : ENSG00000132639

Reagents

Labome : SNAP-antibody