DNASU Plasmid Repository • 480.965.5697 | Email

KLHL18 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  KLHL18
Gene Name:  kelch-like family member 18
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH266876.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082252

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1722nts         Open reading frame : 1 to 1722
Reference Sequence Alignment

ATGGTGGAGGACGGCGCGGAGGAGCTGGAGGATCTGGTGCACTTCTCCGTGTCTGAGTTG
CCTAGTCGCGGCTACGGCGTCATGGAGGAGATCCGGCGGCAGGGCAAGCTGTGCGACGTG
ACCCTCAAGATTGGGGACCACAAATTCAGTGCCCACCGGATTGTCTTGGCAGCCTCGATC
CCGTATTTCCATGCTATGTTTACAAATGACATGATGGAGTGCAAGCAGGATGAGATTGTA
ATGCAAGGAATGGACCCAAGTGCCCTGGAGGCTCTGATCAACTTTGCCTACAACGGCAAC
CTTGCCATTGACCAGCAAAATGTCCAGTCATTGCTGATGGGGGCGAGCTTCCTGCAGCTG
CAGAGCATCAAAGACGCCTGCTGCACATTCCTTCGAGAACGGCTTCACCCAAAAAACTGC
CTGGGTGTGCGCCAGTTTGCTGAGACAATGATGTGTGCTGTGCTGTACGACGCTGCCAAC
AGCTTCATCCACCAGCACTTTGTGGAGGTGTCCATGTCAGAAGAGTTCCTGGCCCTGCCC
TTGGAAGACGTGCTTGAGCTGGTGTCTCGGGATGAGCTGAATGTCAAATCTGAGGAGCAG
GTCTTTGAAGCTGCATTGGCCTGGGTCAGATACGACCGGGAGCAGAGGGGTCCCTACCTG
CCTGAGCTGCTGTCCAATATCCGCCTGCCCCTCTGTCGGCCCCAGTTCCTTTCAGACAGA
GTACAGCAGGATGACCTGGTGCGTTGCTGCCACAAATGCAGGGACCTGGTAGACGAAGCA
AAGGACTACCACCTCATGCCAGAGCGCCGGCCCCACCTGCCAGCTTTCAGAACCCGGCCA
CGCTGCTGCACATCCATCGCTGGACTTATCTACGCTGTAGGGGGCCTCAACTCAGCAGGT
GATTCCCTGAATGTGGTGGAAGTGTTCGACCCCATTGCCAATTGCTGGGAGAGATGCCGT
CCCATGACAACAGCCCGCAGCCGCGTTGGCGTGGCTGTGGTGAACGGGCTTCTCTATGCC
ATCGGAGGATATGACGGCCAGCTACGGCTGAGCACTGTGGAGGCCTACAACCCGGAGACA
GACACATGGACCAGAGTGGGGAGCATGAATAGCAAGAGAAGTGCCATGGGGACAGTCGTG
CTGGATGGGCAGATCTACGTCTGTGGGGGCTACGATGGCAACTCTTCCCTCAGCTCCGTG
GAGACCTACTCACCTGAGACGGACAAATGGACAGTGGTGACCTCGATGAGCTCGAATCGC
AGTGCTGCTGGGGTTACAGTCTTTGAGGGCAGGATATATGTGTCAGGCGGCCATGATGGT
TTGCAGATCTTCAGCAGTGTGGAACACTACAACCACCACACAGCCACCTGGCACCCTGCA
GCTGGCATGCTCAACAAGCGCTGCCGGCACGGAGCCGCCTCCCTGGGGAGCAAGATGTTT
GTCTGCGGGGGCTACGATGGCTCTGGCTTCCTCAGCATTGCCGAGATGTACAGCTCTGTG
GCAGACCAGTGGTGCCTGATTGTCCCCATGCACACGCGCAGGAGCCGGGTCTCCCTGGTG
GCCAGCTGTGGGCGCCTCTACGCTGTTGGGGGCTACGACGGACAGTCAAACCTAAGCTCA
GTGGAGATGTATGACCCAGAGACAGACTGCTGGACATTCATGGCCCCCATGGCGTGCCAT
GAGGGAGGGGTCGGTGTGGGCTGCATCCCTCTCCTCACCATC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1741
Start on reference sequence 17
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagctggcaCC

3' Linker Sequence:
GGCGacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : KLHL18
Symbol Nomenclature : KLHL18
Designation : kelch-like protein 18
Full Nomenclature : kelch-like family member 18
GENEID : 23276
Locus Tag : OK/SW-cl.74
GI : 117645361
GenBank Accession : AM393269
HGNC : 29120
Vega : OTTHUMG00000156522
Target GenBank: NM_025010

 

Reference Sequence Alignment

  

HsCD00082252      ATGGTGGAGGACGGCGCGGAGGAGCTGGAGGATCTGGTGCACTTCTCCGTGTCTGAGTTG
NM_025010.4       ATGGTGGAGGACGGCGCGGAGGAGCTGGAGGATCTGGTGCACTTCTCCGTGTCTGAGTTG
                  ************************************************************

HsCD00082252      CCTAGTCGCGGCTACGGCGTCATGGAGGAGATCCGGCGGCAGGGCAAGCTGTGCGACGTG
NM_025010.4       CCTAGTCGCGGCTACGGCGTCATGGAGGAGATCCGGCGGCAGGGCAAGCTGTGCGACGTG
                  ************************************************************

HsCD00082252      ACCCTCAAGATTGGGGACCACAAATTCAGTGCCCACCGGATTGTCTTGGCAGCCTCGATC
NM_025010.4       ACCCTCAAGATTGGGGACCACAAATTCAGTGCCCACCGGATTGTCTTAGCAGCCTCGATC
                  ***********************************************.************

HsCD00082252      CCGTATTTCCATGCTATGTTTACAAATGACATGATGGAGTGCAAGCAGGATGAGATTGTA
NM_025010.4       CCGTATTTCCATGCTATGTTTACAAATGACATGATGGAGTGCAAGCAGGATGAGATTGTA
                  ************************************************************

HsCD00082252      ATGCAAGGAATGGACCCAAGTGCCCTGGAGGCTCTGATCAACTTTGCCTACAACGGCAAC
NM_025010.4       ATGCAAGGAATGGACCCAAGTGCCCTGGAGGCTCTGATCAACTTTGCCTACAACGGCAAC
                  ************************************************************

HsCD00082252      CTTGCCATTGACCAGCAAAATGTCCAGTCATTGCTGATGGGGGCGAGCTTCCTGCAGCTG
NM_025010.4       CTTGCCATTGACCAGCAAAATGTCCAGTCATTGCTGATGGGGGCGAGCTTCCTGCAGCTG
                  ************************************************************

HsCD00082252      CAGAGCATCAAAGACGCCTGCTGCACATTCCTTCGAGAACGGCTTCACCCAAAAAACTGC
NM_025010.4       CAGAGCATCAAAGACGCCTGCTGCACATTCCTTCGAGAACGGCTTCACCCAAAAAACTGC
                  ************************************************************

HsCD00082252      CTGGGTGTGCGCCAGTTTGCTGAGACAATGATGTGTGCTGTGCTGTACGACGCTGCCAAC
NM_025010.4       CTGGGTGTGCGCCAGTTTGCTGAGACAATGATGTGTGCTGTGCTGTACGACGCTGCCAAC
                  ************************************************************

HsCD00082252      AGCTTCATCCACCAGCACTTTGTGGAGGTGTCCATGTCAGAAGAGTTCCTGGCCCTGCCC
NM_025010.4       AGCTTCATCCACCAGCACTTTGTGGAGGTGTCCATGTCAGAAGAGTTCCTGGCCCTGCCC
                  ************************************************************

HsCD00082252      TTGGAAGACGTGCTTGAGCTGGTGTCTCGGGATGAGCTGAATGTCAAATCTGAGGAGCAG
NM_025010.4       TTGGAAGACGTGCTTGAGCTGGTGTCTCGGGATGAGCTGAATGTCAAATCTGAGGAGCAG
                  ************************************************************

HsCD00082252      GTCTTTGAAGCTGCATTGGCCTGGGTCAGATACGACCGGGAGCAGAGGGGTCCCTACCTG
NM_025010.4       GTCTTTGAAGCTGCATTGGCCTGGGTCAGATACGACCGGGAGCAGAGGGGTCCCTACCTG
                  ************************************************************

HsCD00082252      CCTGAGCTGCTGTCCAATATCCGCCTGCCCCTCTGTCGGCCCCAGTTCCTTTCAGACAGA
NM_025010.4       CCTGAGCTGCTGTCCAATATCCGCCTGCCCCTCTGTCGGCCCCAGTTCCTTTCAGACAGA
                  ************************************************************

HsCD00082252      GTACAGCAGGATGACCTGGTGCGTTGCTGCCACAAATGCAGGGACCTGGTAGACGAAGCA
NM_025010.4       GTACAGCAGGATGACCTGGTGCGTTGCTGCCACAAATGCAGGGACCTGGTAGACGAAGCA
                  ************************************************************

HsCD00082252      AAGGACTACCACCTCATGCCAGAGCGCCGGCCCCACCTGCCAGCTTTCAGAACCCGGCCA
NM_025010.4       AAGGACTACCACCTCATGCCAGAGCGCCGGCCCCACCTGCCAGCTTTCAGAACCCGGCCA
                  ************************************************************

HsCD00082252      CGCTGCTGCACATCCATCGCTGGACTTATCTACGCTGTAGGGGGCCTCAACTCAGCAGGT
NM_025010.4       CGCTGCTGCACATCCATCGCTGGACTTATCTACGCTGTAGGGGGCCTCAACTCAGCAGGT
                  ************************************************************

HsCD00082252      GATTCCCTGAATGTGGTGGAAGTGTTCGACCCCATTGCCAATTGCTGGGAGAGATGCCGT
NM_025010.4       GATTCCCTGAATGTGGTGGAAGTGTTCGACCCCATTGCCAATTGCTGGGAGAGATGCCGT
                  ************************************************************

HsCD00082252      CCCATGACAACAGCCCGCAGCCGCGTTGGCGTGGCTGTGGTGAACGGGCTTCTCTATGCC
NM_025010.4       CCCATGACAACAGCCCGCAGCCGCGTTGGCGTGGCTGTGGTGAACGGGCTTCTCTATGCC
                  ************************************************************

HsCD00082252      ATCGGAGGATATGACGGCCAGCTACGGCTGAGCACTGTGGAGGCCTACAACCCGGAGACA
NM_025010.4       ATCGGAGGATATGACGGCCAGCTACGGCTGAGCACTGTGGAGGCCTACAACCCGGAGACA
                  ************************************************************

HsCD00082252      GACACATGGACCAGAGTGGGGAGCATGAATAGCAAGAGAAGTGCCATGGGGACAGTCGTG
NM_025010.4       GACACATGGACCAGAGTGGGGAGCATGAATAGCAAGAGAAGTGCCATGGGGACAGTCGTG
                  ************************************************************

HsCD00082252      CTGGATGGGCAGATCTACGTCTGTGGGGGCTACGATGGCAACTCTTCCCTCAGCTCCGTG
NM_025010.4       CTGGATGGGCAGATCTACGTCTGTGGGGGCTACGATGGCAACTCTTCCCTCAGCTCCGTG
                  ************************************************************

HsCD00082252      GAGACCTACTCACCTGAGACGGACAAATGGACAGTGGTGACCTCGATGAGCTCGAATCGC
NM_025010.4       GAGACCTACTCACCTGAGACGGACAAATGGACAGTGGTGACCTCGATGAGCTCGAATCGC
                  ************************************************************

HsCD00082252      AGTGCTGCTGGGGTTACAGTCTTTGAGGGCAGGATATATGTGTCAGGCGGCCATGATGGT
NM_025010.4       AGTGCTGCTGGGGTTACAGTCTTTGAGGGCAGGATATATGTGTCAGGCGGCCATGATGGT
                  ************************************************************

HsCD00082252      TTGCAGATCTTCAGCAGTGTGGAACACTACAACCACCACACAGCCACCTGGCACCCTGCA
NM_025010.4       TTGCAGATCTTCAGCAGTGTGGAACACTACAACCACCACACAGCCACCTGGCACCCTGCA
                  ************************************************************

HsCD00082252      GCTGGCATGCTCAACAAGCGCTGCCGGCACGGAGCCGCCTCCCTGGGGAGCAAGATGTTT
NM_025010.4       GCTGGCATGCTCAACAAGCGCTGCCGGCACGGAGCCGCCTCCCTGGGGAGCAAGATGTTT
                  ************************************************************

HsCD00082252      GTCTGCGGGGGCTACGATGGCTCTGGCTTCCTCAGCATTGCCGAGATGTACAGCTCTGTG
NM_025010.4       GTCTGCGGGGGCTACGATGGCTCTGGCTTCCTCAGCATTGCCGAGATGTACAGCTCTGTG
                  ************************************************************

HsCD00082252      GCAGACCAGTGGTGCCTGATTGTCCCCATGCACACGCGCAGGAGCCGGGTCTCCCTGGTG
NM_025010.4       GCAGACCAGTGGTGCCTGATTGTCCCCATGCACACGCGCAGGAGCCGGGTCTCCCTGGTG
                  ************************************************************

HsCD00082252      GCCAGCTGTGGGCGCCTCTACGCTGTTGGGGGCTACGACGGACAGTCAAACCTAAGCTCA
NM_025010.4       GCCAGCTGTGGGCGCCTCTACGCTGTTGGGGGCTACGACGGACAGTCAAACCTAAGCTCA
                  ************************************************************

HsCD00082252      GTGGAGATGTATGACCCAGAGACAGACTGCTGGACATTCATGGCCCCCATGGCGTGCCAT
NM_025010.4       GTGGAGATGTATGACCCAGAGACAGACTGCTGGACATTCATGGCCCCCATGGCGTGCCAT
                  ************************************************************

HsCD00082252      GAGGGAGGGGTCGGTGTGGGCTGCATCCCTCTCCTCACCATC---
NM_025010.4       GAGGGAGGGGTCGGTGTGGGCTGCATCCCTCTCCTCACCATCTAA
                  ******************************************   

Protein

SMART domain : Kelch :
SMART domain : BACK : BTB And C-terminal Kelch
SMART domain : BTB : Broad-Complex, Tramtrack and Bric a brac
UniProt : O94889
HPRD : 10017

Clone

Cloning Information : 266876
HIP Master Clone ID : 198974
IMAGE ID : 100002136
Original Clone ID : FLH266876.01L

Organism


TAX_ID : 9606
Species Specific ID: 23276

Genome

Chromosome : 3
Map Location : 3p21.31
Ensembl : ENSG00000114648

Reagents

Labome : KLHL18-antibody