DNASU Plasmid Repository • 480.965.5697 | Email

CYP19A1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  CYP19A1
Gene Name:  cytochrome P450, family 19, subfamily A, polypeptide 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH267002.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1509nts         Open reading frame : 1 to 1509
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1651
Start on reference sequence 140
a278g,E93G; t1430c,L477S

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : CYP19A1
Symbol Nomenclature : CYP19A1
Designation : aromatase|cytochrome P-450AROM|cytochrome P450 19A1|cytochrome P450, subfamily XIX (aromatization of androgens)|estrogen synthase|estrogen synthetase|flavoprotein-linked monooxygenase|microsomal monooxygenase
Full Nomenclature : cytochrome P450, family 19, subfamily A, polypeptide 1
GENEID : 1588
GI : 117645191
GenBank Accession : AM393184
HGNC : 2594
MIM : 107910
Vega : OTTHUMG00000131747
Target GenBank: BC035959


Reference Sequence Alignment












                    ****************** *****************************************













                    ************************************************* **********


HsCD00082378        CTGGAACAC---
NM_031226.2         CTGGAACACTAG
XM_005254190.1      CTGGAACACTAG
XM_005254191.1      CTGGAACACTAG
NM_000103.3         CTGGAACACTAG


Panther : Androgen/estrogene/progesterone biosynthesis
Reactome : Biological oxidations
Reactome : Cytochrome P450 - arranged by substrate type
Reactome : Endogenous sterols
Reactome : Estrogen biosynthesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Metabolism of steroid hormones and vitamin D
Reactome : Phase 1 - Functionalization of compounds
Reactome : Steroid hormones
WikiPathway : FSH signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : Tryptophan metabolism
WikiPathway : cytochrome P450
WikiPathway : metapathway biotransformation


UniProt : A8K6W3
UniProt : Q05CU4
UniProt : Q8TCA4
UniProt : P11511
HPRD : 00488


Cloning Information : 267002
HIP Master Clone ID : 199100
IMAGE ID : 100002595
Original Clone ID : FLH267002.01L


TAX_ID : 9606
Species Specific ID: 1588


Chromosome : 15
Map Location : 15q21.1
Ensembl : ENSG00000137869


Labome : aromatase-antibody