DNASU Plasmid Repository • 480.965.5697 | Email

CYP19A1 (Homo sapiens) in pJFT7_nHalo_DC(r4)

TOP

Explanation of Terms


Gene: Gene Symbol:  CYP19A1
Gene Name:  cytochrome P450 family 19 subfamily A member 1
Sequence             
Original Clone ID: None
Keyword: "insert_ID 57250,DNASU_Clone_ID HsCD00082378"
Species: Homo sapiens
Type: cDNA
Vector Name: pJFT7_nHalo_DC(r4)               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00824524

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1509nts         Open reading frame : 1 to 1509

ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTG
TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGGAACACTCATTATCAGCAAGTCC
TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
ACGCTCTTCTTGAGGATCTCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTCGTCCTTGCAC
CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
CTGGAACAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_nHalo_DC(r4)

pJFT7_nHalo_DCr4 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  HaloseqF
Reverse:  pant1627r
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: One in a series of pJFT7 vectors made by J. Saul for IVTT protein expression at CPD. This vector has been modified to improve sequencing the insert with a reverse primer.
Size (bp): 6140
Parent Vector: None
Empty Vector: EvNO00623723
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
Andrea Throop
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3425 4107
death cassette ccdB ccdB death cassette (removed in plasmids containing a gene insert) 2785 2994
enhancer CITE CITE enhancer 17 515
protease cleavage site TEV TEV protease cleavage site 1422 1442
recombination site attR1 attR1 recombination site 1458 1474
recombination site attR2 recombination site 3145 3160
selectable marker AmpR ampicillin resistance 4205 4864
selectable marker CmR chloramphenicol resistance (removed in clones containing a gene insert) 1691 2347
ssDNA origin f1 f1 origin 5633 5939
tag HALO N-terminal HALO tag 522 1409

 

  • Gene
  • Clone
  • Organism

Gene

Target GenBank: BC035959

 

Clone

Cloning Information : 924480

Organism


Species Specific ID: 1588