DNASU Plasmid Repository • 480.965.5697 | Email

NNT (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NNT
Gene Name:  nicotinamide nucleotide transhydrogenase
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH267091.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
HsCD00082467

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3258nts         Open reading frame : 1 to 3258
Reference Sequence Alignment

ATGGCAAACCTATTGAAAACAGTGGTGACTGGCTGCTCGTGTCCTCTACTTAGCAATTTG
GGGTCCTGTAAGGGTCTACGTGTGAAGAAGGATTTTTTACGAACATTTTATACTCACCAA
GAACTGTGGTGTAAAGCGCCTGTAAAACCAGGAATTCCATATAAGCAACTGACTGTTGGA
GTCCCCAAAGAGATATTCCAAAATGAGAAGCGAGTGGCATTGTCTCCTGCTGGTGTTCAG
AACTTGGTCAAGCAGGGTTTTAATGTTGTCGTGGAATCGGGTGCGGGCGAAGCTTCCAAG
TTCTCAGATGATCACTATAGAGTGGCAGGTGCCCAAATCCAAGGGGCAAAGGAAGTGCTG
GCTTCTGATTTGGTGGTCAAAGTGCGAGCCCCTATGGTTAATCCAACATTAGGTGTTCAT
GAAGCTGACCTTTTAAAGACATCAGGAACGCTGATTAGTTTTATTTACCCAGCCCAAAAT
CCAGAGTTGCTAAATAAACTTTCCCAAAGAAAAACTACAGTTCTGGCAATGGACCAGGTT
CCAAGAGTCACAATTGCTCAGGGATATGATGCGCTAAGCTCCATGGCCAACATTGCGGGT
TATAAGGCTGTTGTCCTAGCAGCAAATCATTTTGAACGTTTTTTTACTGGTCAGATCACA
GCTGCTGGAAAAGTTCCTCCAGCTAAGATTCTGATAGTTGGTGGTGGTGTTGCTGGGCTT
GCTTCTGCAGGCGCAGCAAAGTCGATGGGTGCAATTGTTCGAGGATTTGACACAAGAGCT
GCAGCTTTGGAACAGTTCAAGTCTCTTGGTGCTGAGCCCTTGGAGGTGGACTTGAAGGAA
TCTGGTGAGGGACAAGGAGGATATGCAAAAGAGATGTCCAAAGAGTTCATTGAAGCTGAA
ATGGAACTCTTTGCTCAACAATGCAAGGAGGTAGACATCCTTATCAGCACAGCACTTATT
CCAGGTAAAAAAGCTCCAGTTTTATTTAATAAAGAAATGATTGAGTCAATGAAGGAAGGT
TCAGTTGTTGTGGATTTAGCTGCTGAGGCTGGTGGAAACTTTGAAACCACTAAGCCAGGA
GAACTCTACATTCATAAGGGAATTACTCACATAGGCTACACAGACCTGCCCAGCCGAATG
GCCACTCAGGCCAGCACCCTATATTCCAACAACATCACCAAACTCCTGAAGGCCATCAGC
CCGGACAAAGATAATTTTTATTTTGATGTGAAAGATGACTTTGACTTTGGTACGATGGGT
CATGTCATTAGAGGAACTGTAGTGATGAAAGATGGTAAAGTGATTTTCCCAGCTCCCACA
CCGAAAAATATTCCTCAGGGTGCCCCAGTAAAACAGAAGACAGTGGCTGAGCTGGAAGCT
GAAAAAGCAGCTACCATTACACCCTTCAGGAAGACAATGTCAACGGCTTCTGCATATACA
GCAGGTCTCACAGGGATACTGGGTTTGGGCATTGCGGCTCCCAATCTAGCCTTTTCTCAG
ATGGTGACCACTTTTGGCTTGGCTGGCATTGTGGGGTATCATACCGTCTGGGGAGTGACC
CCTGCTCTCCACTCACCACTGATGTCTGTGACAAATGCAATCTCAGGGCTGACTGCAGTT
GGTGGGTTGGCACTGATGGGAGGACATTTGTATCCTTCCACAACTTCTCAGGGCCTTGCT
GCTCTTGCTGCATTCATATCCTCTGTCAACATTGCAGGTGGCTTTCTGGTGACTCAGAGA
ATGCTGGACATGTTCAAGCGTCCCACTGACCCCCCAGAATACAACTACCTGTACCTGCTC
CCTGCCGGCACCTTTGTTGGTGGATATTTAGCTGCCCTCTACAGTGGTTATAACATTGAA
CAGATCATGTACCTAGGCTCGGGTTTGTGCTGTGTCGGTGCCTTGGCTGGCCTCTCCACC
CAGGGAACAGCACGTCTTGGCAATGCACTGGGCATGATTGGGGTTGCTGGAGGACTGGCA
GCCACCCTCGGAGTCCTAAAACCGGGCCCAGAATTACTAGCTCAGATGTCTGGAGCGATG
GCTTTGGGTGGTACCATTGGATCGACAATTGCCAAACGCATCCAGATTTCTGATTTACCT
CAATTAGTTGCTGCTTTTCACAGTTTAGTGGGTTTGGCAGCTGTACTTACTTGCATAGCT
GAGTACATTATAGAATATCCACATTTTGCTACGGACGCAGCAGCAAATCTCACCAAGATT
GTGGCCTACCTCGGCACTTACATTGGTGGCGTCACCTTTAGTGGGTCTCTCATTGCCTAT
GGAAAATTGCAGGGTCTCCTGAAATCTGCCCCTCTCCTACTGCCTGGAAGGCACTTACTC
AATGCAGGCTTACTGGCTGCTAGTGTGGGCGGGATAATCCCATTCATGGTGGACCCAAGC
TTTACTACTGGCATCACCTGTCTGGGTTCAGTGTCTGCTCTCTCTGCTGTCATGGGTGTG
ACTTTGACAGCTGCTATTGGGGGTGCTGACATGCCCGTCGTTATCACTGTGCTGAACAGC
TACTCAGGCTGGGCCCTGTGTGCAGAGGGCTTCCTGCTCAACAACAATCTGCTGACCATC
GTGGGTGCACTCATAGGCTCGTCTGGTGCTATCCTGTCATACATCATGTGTGTGGCAATG
AATCGCTCCCTGGCTAATGTGATTCTTGGAGGCTATGGCACCACTTCAACAGCTGGTGGA
AAACCCATGGAAATTTCTGGCACACATACGGAAATCAACCTTGACAATGCAATTGACATG
ATTCGAGAAGCTAATAGCATTATTATTACACCAGGCTATGGTCTCTGTGCAGCCAAAGCT
CAATACCCCATTGCTGATTTGGTAAAGATGCTCACTGAGCAAGGCAAAAAAGTCAGGTTT
GGAATTCACCCAGTTGCAGGCCGAATGCCTGGTCAGCTTAATGTGCTGCTGGCTGAGGCT
GGTGTGCCATATGACATTGTGTTGGAAATGGATGAGATCAACCATGATTTTCCAGATACT
GATTTGGTCCTTGTAATTGGAGCTAATGACACTGTTAATTCAGCAGCTCAAGAAGATCCC
AACTCTATTATTGCAGGCATGCCAGTCCTTGAGGTCTGGAAATCAAAGCAGGTGATTGTT
ATGAAGAGGTCTTTGGGTGTTGGCTATGCTGCAGTGGACAATCCAATCTTCTACAGACCT
AACACGGCCATGCTTCTAGGTGATGCCAAGAAAACATGTGACGCGCTCCAGGCGAAAGTT
AGAGAATCCTATCAGAAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3483
Start on reference sequence 223
Mutations:
None
Discrepancy:
a904g,K302E; a1338g;
 t2063c,L688S
                                

5' Linker Sequence:
gtacaaaaaagctggcaCC

3' Linker Sequence:
GGCGacccagctttcttgtaca

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NNT
Symbol Nomenclature : NNT
SYNONYM : GCCD4
Designation : NAD(P) transhydrogenase, mitochondrial|pyridine nucleotide transhydrogenase
Full Nomenclature : nicotinamide nucleotide transhydrogenase
GENEID : 23530
Locus Tag : hCG_17428
GI : 117646047
GenBank Accession : AM393615
HGNC : 7863
MIM : 607878
Vega : OTTHUMG00000096961
Target GenBank: AL831822

 

Reference Sequence Alignment

  

HsCD00082467      ATGGCAAACCTATTGAAAACAGTGGTGACTGGCTGCTCGTGTCCTCTACTTAGCAATTTG
NM_012343.3       ATGGCAAACCTATTGAAAACAGTGGTGACTGGCTGCTCGTGTCCTCTACTTAGCAATTTG
NM_182977.2       ATGGCAAACCTATTGAAAACAGTGGTGACTGGCTGCTCGTGTCCTCTACTTAGCAATTTG
                  ************************************************************

HsCD00082467      GGGTCCTGTAAGGGTCTACGTGTGAAGAAGGATTTTTTACGAACATTTTATACTCACCAA
NM_012343.3       GGGTCCTGTAAGGGTCTACGTGTGAAGAAGGATTTTTTACGAACATTTTATACTCACCAA
NM_182977.2       GGGTCCTGTAAGGGTCTACGTGTGAAGAAGGATTTTTTACGAACATTTTATACTCACCAA
                  ************************************************************

HsCD00082467      GAACTGTGGTGTAAAGCGCCTGTAAAACCAGGAATTCCATATAAGCAACTGACTGTTGGA
NM_012343.3       GAACTGTGGTGTAAAGCGCCTGTAAAACCAGGAATTCCATATAAGCAACTGACTGTTGGA
NM_182977.2       GAACTGTGGTGTAAAGCGCCTGTAAAACCAGGAATTCCATATAAGCAACTGACTGTTGGA
                  ************************************************************

HsCD00082467      GTCCCCAAAGAGATATTCCAAAATGAGAAGCGAGTGGCATTGTCTCCTGCTGGTGTTCAG
NM_012343.3       GTCCCCAAAGAGATATTCCAAAATGAGAAGCGAGTGGCATTGTCTCCTGCTGGTGTTCAG
NM_182977.2       GTCCCCAAAGAGATATTCCAAAATGAGAAGCGAGTGGCATTGTCTCCTGCTGGTGTTCAG
                  ************************************************************

HsCD00082467      AACTTGGTCAAGCAGGGTTTTAATGTTGTCGTGGAATCGGGTGCGGGCGAAGCTTCCAAG
NM_012343.3       AACTTGGTCAAGCAGGGTTTTAATGTTGTCGTGGAATCGGGTGCGGGCGAAGCTTCCAAG
NM_182977.2       AACTTGGTCAAGCAGGGTTTTAATGTTGTCGTGGAATCGGGTGCGGGCGAAGCTTCCAAG
                  ************************************************************

HsCD00082467      TTCTCAGATGATCACTATAGAGTGGCAGGTGCCCAAATCCAAGGGGCAAAGGAAGTGCTG
NM_012343.3       TTCTCAGATGATCACTATAGAGTGGCAGGTGCCCAAATCCAAGGGGCAAAGGAAGTGCTG
NM_182977.2       TTCTCAGATGATCACTATAGAGTGGCAGGTGCCCAAATCCAAGGGGCAAAGGAAGTGCTG
                  ************************************************************

HsCD00082467      GCTTCTGATTTGGTGGTCAAAGTGCGAGCCCCTATGGTTAATCCAACATTAGGTGTTCAT
NM_012343.3       GCTTCTGATTTGGTGGTCAAAGTGCGAGCCCCTATGGTTAATCCAACATTAGGTGTTCAT
NM_182977.2       GCTTCTGATTTGGTGGTCAAAGTGCGAGCCCCTATGGTTAATCCAACATTAGGTGTTCAT
                  ************************************************************

HsCD00082467      GAAGCTGACCTTTTAAAGACATCAGGAACGCTGATTAGTTTTATTTACCCAGCCCAAAAT
NM_012343.3       GAAGCTGACCTTTTAAAGACATCAGGAACGCTGATTAGTTTTATTTACCCAGCCCAAAAT
NM_182977.2       GAAGCTGACCTTTTAAAGACATCAGGAACGCTGATTAGTTTTATTTACCCAGCCCAAAAT
                  ************************************************************

HsCD00082467      CCAGAGTTGCTAAATAAACTTTCCCAAAGAAAAACTACAGTTCTGGCAATGGACCAGGTT
NM_012343.3       CCAGAGTTGCTAAATAAACTTTCCCAAAGAAAAACTACAGTTCTGGCAATGGACCAGGTT
NM_182977.2       CCAGAGTTGCTAAATAAACTTTCCCAAAGAAAAACTACAGTTCTGGCAATGGACCAGGTT
                  ************************************************************

HsCD00082467      CCAAGAGTCACAATTGCTCAGGGATATGATGCGCTAAGCTCCATGGCCAACATTGCGGGT
NM_012343.3       CCAAGAGTCACAATTGCTCAGGGATATGATGCGCTAAGCTCCATGGCCAACATTGCGGGT
NM_182977.2       CCAAGAGTCACAATTGCTCAGGGATATGATGCGCTAAGCTCCATGGCCAACATTGCGGGT
                  ************************************************************

HsCD00082467      TATAAGGCTGTTGTCCTAGCAGCAAATCATTTTGAACGTTTTTTTACTGGTCAGATCACA
NM_012343.3       TATAAGGCTGTTGTCCTAGCAGCAAATCATTTTGGACGTTTTTTTACTGGTCAGATCACA
NM_182977.2       TATAAGGCTGTTGTCCTAGCAGCAAATCATTTTGGACGTTTTTTTACTGGTCAGATCACA
                  **********************************.*************************

HsCD00082467      GCTGCTGGAAAAGTTCCTCCAGCTAAGATTCTGATAGTTGGTGGTGGTGTTGCTGGGCTT
NM_012343.3       GCTGCTGGAAAAGTTCCTCCAGCTAAGATTCTGATAGTTGGTGGTGGTGTTGCTGGGCTT
NM_182977.2       GCTGCTGGAAAAGTTCCTCCAGCTAAGATTCTGATAGTTGGTGGTGGTGTTGCTGGGCTT
                  ************************************************************

HsCD00082467      GCTTCTGCAGGCGCAGCAAAGTCGATGGGTGCAATTGTTCGAGGATTTGACACAAGAGCT
NM_012343.3       GCTTCTGCAGGCGCAGCAAAGTCGATGGGTGCAATTGTTCGAGGATTTGACACAAGAGCT
NM_182977.2       GCTTCTGCAGGCGCAGCAAAGTCGATGGGTGCAATTGTTCGAGGATTTGACACAAGAGCT
                  ************************************************************

HsCD00082467      GCAGCTTTGGAACAGTTCAAGTCTCTTGGTGCTGAGCCCTTGGAGGTGGACTTGAAGGAA
NM_012343.3       GCAGCTTTGGAACAGTTCAAGTCTCTTGGTGCTGAGCCCTTGGAGGTGGACTTGAAGGAA
NM_182977.2       GCAGCTTTGGAACAGTTCAAGTCTCTTGGTGCTGAGCCCTTGGAGGTGGACTTGAAGGAA
                  ************************************************************

HsCD00082467      TCTGGTGAGGGACAAGGAGGATATGCAAAAGAGATGTCCAAAGAGTTCATTGAAGCTGAA
NM_012343.3       TCTGGTGAGGGACAAGGAGGATATGCAAAAGAGATGTCCAAAGAGTTCATTGAAGCTGAA
NM_182977.2       TCTGGTGAGGGACAAGGAGGATATGCAAAAGAGATGTCCAAAGAGTTCATTGAAGCTGAA
                  ************************************************************

HsCD00082467      ATGGAACTCTTTGCTCAACAATGCAAGGAGGTAGACATCCTTATCAGCACAGCACTTATT
NM_012343.3       ATGAAACTCTTTGCTCAACAATGCAAGGAGGTAGACATCCTTATCAGCACAGCACTTATT
NM_182977.2       ATGAAACTCTTTGCTCAACAATGCAAGGAGGTAGACATCCTTATCAGCACAGCACTTATT
                  ***.********************************************************

HsCD00082467      CCAGGTAAAAAAGCTCCAGTTTTATTTAATAAAGAAATGATTGAGTCAATGAAGGAAGGT
NM_012343.3       CCAGGTAAAAAAGCTCCAGTTTTATTTAATAAAGAAATGATTGAGTCAATGAAGGAAGGT
NM_182977.2       CCAGGTAAAAAAGCTCCAGTTTTATTTAATAAAGAAATGATTGAGTCAATGAAGGAAGGT
                  ************************************************************

HsCD00082467      TCAGTTGTTGTGGATTTAGCTGCTGAGGCTGGTGGAAACTTTGAAACCACTAAGCCAGGA
NM_012343.3       TCAGTTGTTGTGGATTTAGCTGCTGAGGCTGGTGGAAACTTTGAAACCACTAAGCCAGGA
NM_182977.2       TCAGTTGTTGTGGATTTAGCTGCTGAGGCTGGTGGAAACTTTGAAACCACTAAGCCAGGA
                  ************************************************************

HsCD00082467      GAACTCTACATTCATAAGGGAATTACTCACATAGGCTACACAGACCTGCCCAGCCGAATG
NM_012343.3       GAACTCTACATTCATAAGGGAATTACTCACATAGGCTACACAGACCTGCCCAGCCGAATG
NM_182977.2       GAACTCTACATTCATAAGGGAATTACTCACATAGGCTACACAGACCTGCCCAGCCGAATG
                  ************************************************************

HsCD00082467      GCCACTCAGGCCAGCACCCTATATTCCAACAACATCACCAAACTCCTGAAGGCCATCAGC
NM_012343.3       GCCACTCAGGCCAGCACCCTATATTCCAACAACATCACCAAACTCCTGAAGGCCATCAGC
NM_182977.2       GCCACTCAGGCCAGCACCCTATATTCCAACAACATCACCAAACTCCTGAAGGCCATCAGC
                  ************************************************************

HsCD00082467      CCGGACAAAGATAATTTTTATTTTGATGTGAAAGATGACTTTGACTTTGGTACGATGGGT
NM_012343.3       CCGGACAAAGATAATTTTTATTTTGATGTGAAAGATGACTTTGACTTTGGTACGATGGGT
NM_182977.2       CCGGACAAAGATAATTTTTATTTTGATGTGAAAGATGACTTTGACTTTGGTACGATGGGT
                  ************************************************************

HsCD00082467      CATGTCATTAGAGGAACTGTAGTGATGAAAGATGGTAAAGTGATTTTCCCAGCTCCCACA
NM_012343.3       CATGTCATTAGAGGAACTGTAGTGATGAAAGATGGTAAAGTGATTTTCCCAGCTCCCACA
NM_182977.2       CATGTCATTAGAGGAACTGTAGTGATGAAAGATGGTAAAGTGATTTTCCCAGCTCCCACA
                  ************************************************************

HsCD00082467      CCGAAAAATATTCCTCAGGGTGCCCCAGTAAAACAGAAGACAGTGGCTGAGCTGGAAGCT
NM_012343.3       CCGAAAAATATTCCTCAAGGTGCCCCAGTAAAACAGAAGACAGTGGCTGAGCTGGAAGCT
NM_182977.2       CCGAAAAATATTCCTCAAGGTGCCCCAGTAAAACAGAAGACAGTGGCTGAGCTGGAAGCT
                  *****************.******************************************

HsCD00082467      GAAAAAGCAGCTACCATTACACCCTTCAGGAAGACAATGTCAACGGCTTCTGCATATACA
NM_012343.3       GAAAAAGCAGCTACCATTACACCCTTCAGGAAGACAATGTCAACGGCTTCTGCATATACA
NM_182977.2       GAAAAAGCAGCTACCATTACACCCTTCAGGAAGACAATGTCAACGGCTTCTGCATATACA
                  ************************************************************

HsCD00082467      GCAGGTCTCACAGGGATACTGGGTTTGGGCATTGCGGCTCCCAATCTAGCCTTTTCTCAG
NM_012343.3       GCAGGTCTCACAGGGATACTGGGTTTGGGCATTGCGGCTCCCAATCTAGCCTTTTCTCAG
NM_182977.2       GCAGGTCTCACAGGGATACTGGGTTTGGGCATTGCGGCTCCCAATCTAGCCTTTTCTCAG
                  ************************************************************

HsCD00082467      ATGGTGACCACTTTTGGCTTGGCTGGCATTGTGGGGTATCATACCGTCTGGGGAGTGACC
NM_012343.3       ATGGTGACCACTTTTGGCTTGGCTGGCATTGTGGGGTATCATACCGTCTGGGGAGTGACC
NM_182977.2       ATGGTGACCACTTTTGGCTTGGCTGGCATTGTGGGGTATCATACCGTCTGGGGAGTGACC
                  ************************************************************

HsCD00082467      CCTGCTCTCCACTCACCACTGATGTCTGTGACAAATGCAATCTCAGGGCTGACTGCAGTT
NM_012343.3       CCTGCTCTCCACTCACCACTGATGTCTGTGACAAATGCAATCTCAGGGCTGACTGCAGTT
NM_182977.2       CCTGCTCTCCACTCACCACTGATGTCTGTGACAAATGCAATCTCAGGGCTGACTGCAGTT
                  ************************************************************

HsCD00082467      GGTGGGTTGGCACTGATGGGAGGACATTTGTATCCTTCCACAACTTCTCAGGGCCTTGCT
NM_012343.3       GGTGGGTTGGCACTGATGGGAGGACATTTGTATCCTTCCACAACTTCTCAGGGCCTTGCT
NM_182977.2       GGTGGGTTGGCACTGATGGGAGGACATTTGTATCCTTCCACAACTTCTCAGGGCCTTGCT
                  ************************************************************

HsCD00082467      GCTCTTGCTGCATTCATATCCTCTGTCAACATTGCAGGTGGCTTTCTGGTGACTCAGAGA
NM_012343.3       GCTCTTGCTGCATTCATATCCTCTGTCAACATTGCAGGTGGCTTTCTGGTGACTCAGAGA
NM_182977.2       GCTCTTGCTGCATTCATATCCTCTGTCAACATTGCAGGTGGCTTTCTGGTGACTCAGAGA
                  ************************************************************

HsCD00082467      ATGCTGGACATGTTCAAGCGTCCCACTGACCCCCCAGAATACAACTACCTGTACCTGCTC
NM_012343.3       ATGCTGGACATGTTCAAGCGTCCCACTGACCCCCCAGAATACAACTACCTGTACCTGCTC
NM_182977.2       ATGCTGGACATGTTCAAGCGTCCCACTGACCCCCCAGAATACAACTACCTGTACCTGCTC
                  ************************************************************

HsCD00082467      CCTGCCGGCACCTTTGTTGGTGGATATTTAGCTGCCCTCTACAGTGGTTATAACATTGAA
NM_012343.3       CCTGCCGGCACCTTTGTTGGTGGATATTTAGCTGCCCTCTACAGTGGTTATAACATTGAA
NM_182977.2       CCTGCCGGCACCTTTGTTGGTGGATATTTAGCTGCCCTCTACAGTGGTTATAACATTGAA
                  ************************************************************

HsCD00082467      CAGATCATGTACCTAGGCTCGGGTTTGTGCTGTGTCGGTGCCTTGGCTGGCCTCTCCACC
NM_012343.3       CAGATCATGTACCTAGGCTCGGGTTTGTGCTGTGTCGGTGCCTTGGCTGGCCTCTCCACC
NM_182977.2       CAGATCATGTACCTAGGCTCGGGTTTGTGCTGTGTCGGTGCCTTGGCTGGCCTCTCCACC
                  ************************************************************

HsCD00082467      CAGGGAACAGCACGTCTTGGCAATGCACTGGGCATGATTGGGGTTGCTGGAGGACTGGCA
NM_012343.3       CAGGGAACAGCACGTCTTGGCAATGCACTGGGCATGATTGGGGTTGCTGGAGGACTGGCA
NM_182977.2       CAGGGAACAGCACGTCTTGGCAATGCACTGGGCATGATTGGGGTTGCTGGAGGACTGGCA
                  ************************************************************

HsCD00082467      GCCACCCTCGGAGTCCTAAAACCGGGCCCAGAATTACTAGCTCAGATGTCTGGAGCGATG
NM_012343.3       GCCACCCTCGGAGTCCTAAAACCGGGCCCAGAATTACTAGCTCAGATGTCTGGAGCGATG
NM_182977.2       GCCACCCTCGGAGTCCTAAAACCGGGCCCAGAATTACTAGCTCAGATGTCTGGAGCGATG
                  ************************************************************

HsCD00082467      GCTTTGGGTGGTACCATTGGATCGACAATTGCCAAACGCATCCAGATTTCTGATTTACCT
NM_012343.3       GCTTTGGGTGGTACCATTGGATTGACAATTGCCAAACGCATCCAGATTTCTGATTTACCT
NM_182977.2       GCTTTGGGTGGTACCATTGGATTGACAATTGCCAAACGCATCCAGATTTCTGATTTACCT
                  ********************** *************************************

HsCD00082467      CAATTAGTTGCTGCTTTTCACAGTTTAGTGGGTTTGGCAGCTGTACTTACTTGCATAGCT
NM_012343.3       CAATTAGTTGCTGCTTTTCACAGTTTAGTGGGTTTGGCAGCTGTACTTACTTGCATAGCT
NM_182977.2       CAATTAGTTGCTGCTTTTCACAGTTTAGTGGGTTTGGCAGCTGTACTTACTTGCATAGCT
                  ************************************************************

HsCD00082467      GAGTACATTATAGAATATCCACATTTTGCTACGGACGCAGCAGCAAATCTCACCAAGATT
NM_012343.3       GAGTACATTATAGAATATCCACATTTTGCTACGGATGCAGCAGCAAATCTCACCAAGATT
NM_182977.2       GAGTACATTATAGAATATCCACATTTTGCTACGGATGCAGCAGCAAATCTCACCAAGATT
                  *********************************** ************************

HsCD00082467      GTGGCCTACCTCGGCACTTACATTGGTGGCGTCACCTTTAGTGGGTCTCTCATTGCCTAT
NM_012343.3       GTGGCCTACCTCGGCACTTACATTGGTGGCGTCACCTTTAGTGGGTCTCTCATTGCCTAT
NM_182977.2       GTGGCCTACCTCGGCACTTACATTGGTGGCGTCACCTTTAGTGGGTCTCTCATTGCCTAT
                  ************************************************************

HsCD00082467      GGAAAATTGCAGGGTCTCCTGAAATCTGCCCCTCTCCTACTGCCTGGAAGGCACTTACTC
NM_012343.3       GGAAAATTGCAGGGTCTCCTGAAATCTGCCCCTCTCCTACTGCCTGGAAGGCACTTACTC
NM_182977.2       GGAAAATTGCAGGGTCTCCTGAAATCTGCCCCTCTCCTACTGCCTGGAAGGCACTTACTC
                  ************************************************************

HsCD00082467      AATGCAGGCTTACTGGCTGCTAGTGTGGGCGGGATAATCCCATTCATGGTGGACCCAAGC
NM_012343.3       AATGCAGGCTTACTGGCTGCTAGTGTGGGCGGGATAATCCCATTCATGGTGGACCCAAGC
NM_182977.2       AATGCAGGCTTACTGGCTGCTAGTGTGGGCGGGATAATCCCATTCATGGTGGACCCAAGC
                  ************************************************************

HsCD00082467      TTTACTACTGGCATCACCTGTCTGGGTTCAGTGTCTGCTCTCTCTGCTGTCATGGGTGTG
NM_012343.3       TTTACTACTGGCATCACCTGTCTGGGTTCAGTGTCTGCTCTCTCTGCTGTCATGGGTGTG
NM_182977.2       TTTACTACTGGCATCACCTGTCTGGGTTCAGTGTCTGCTCTCTCTGCTGTCATGGGTGTG
                  ************************************************************

HsCD00082467      ACTTTGACAGCTGCTATTGGGGGTGCTGACATGCCCGTCGTTATCACTGTGCTGAACAGC
NM_012343.3       ACTTTGACAGCTGCTATTGGGGGTGCTGACATGCCCGTCGTTATCACTGTGCTGAACAGC
NM_182977.2       ACTTTGACAGCTGCTATTGGGGGTGCTGACATGCCCGTCGTTATCACTGTGCTGAACAGC
                  ************************************************************

HsCD00082467      TACTCAGGCTGGGCCCTGTGTGCAGAGGGCTTCCTGCTCAACAACAATCTGCTGACCATC
NM_012343.3       TACTCAGGCTGGGCCCTGTGTGCAGAGGGCTTCCTGCTCAACAACAATCTGCTGACCATC
NM_182977.2       TACTCAGGCTGGGCCCTGTGTGCAGAGGGCTTCCTGCTCAACAACAATCTGCTGACCATC
                  ************************************************************

HsCD00082467      GTGGGTGCACTCATAGGCTCGTCTGGTGCTATCCTGTCATACATCATGTGTGTGGCAATG
NM_012343.3       GTGGGTGCACTCATAGGCTCGTCTGGTGCTATCCTGTCATACATCATGTGTGTGGCAATG
NM_182977.2       GTGGGTGCACTCATAGGCTCGTCTGGTGCTATCCTGTCATACATCATGTGTGTGGCAATG
                  ************************************************************

HsCD00082467      AATCGCTCCCTGGCTAATGTGATTCTTGGAGGCTATGGCACCACTTCAACAGCTGGTGGA
NM_012343.3       AATCGCTCCCTGGCTAATGTGATTCTTGGAGGCTATGGCACCACTTCAACAGCTGGTGGA
NM_182977.2       AATCGCTCCCTGGCTAATGTGATTCTTGGAGGCTATGGCACCACTTCAACAGCTGGTGGA
                  ************************************************************

HsCD00082467      AAACCCATGGAAATTTCTGGCACACATACGGAAATCAACCTTGACAATGCAATTGACATG
NM_012343.3       AAACCCATGGAAATTTCTGGCACACATACGGAAATCAACCTTGACAATGCAATTGACATG
NM_182977.2       AAACCCATGGAAATTTCTGGCACACATACGGAAATCAACCTTGACAATGCAATTGACATG
                  ************************************************************

HsCD00082467      ATTCGAGAAGCTAATAGCATTATTATTACACCAGGCTATGGTCTCTGTGCAGCCAAAGCT
NM_012343.3       ATTCGAGAAGCTAATAGCATTATTATTACACCAGGCTATGGTCTCTGTGCAGCCAAAGCT
NM_182977.2       ATTCGAGAAGCTAATAGCATTATTATTACACCAGGCTATGGTCTCTGTGCAGCCAAAGCT
                  ************************************************************

HsCD00082467      CAATACCCCATTGCTGATTTGGTAAAGATGCTCACTGAGCAAGGCAAAAAAGTCAGGTTT
NM_012343.3       CAATACCCCATTGCTGATTTGGTAAAGATGCTCACTGAGCAAGGCAAAAAAGTCAGGTTT
NM_182977.2       CAATACCCCATTGCTGATTTGGTAAAGATGCTCACTGAGCAAGGCAAAAAAGTCAGGTTT
                  ************************************************************

HsCD00082467      GGAATTCACCCAGTTGCAGGCCGAATGCCTGGTCAGCTTAATGTGCTGCTGGCTGAGGCT
NM_012343.3       GGAATTCACCCAGTTGCAGGCCGAATGCCTGGTCAGCTTAATGTGCTGCTGGCTGAGGCT
NM_182977.2       GGAATTCACCCAGTTGCAGGCCGAATGCCTGGTCAGCTTAATGTGCTGCTGGCTGAGGCT
                  ************************************************************

HsCD00082467      GGTGTGCCATATGACATTGTGTTGGAAATGGATGAGATCAACCATGATTTTCCAGATACT
NM_012343.3       GGTGTGCCATATGACATTGTGTTGGAAATGGATGAGATCAACCATGATTTTCCAGATACT
NM_182977.2       GGTGTGCCATATGACATTGTGTTGGAAATGGATGAGATCAACCATGATTTTCCAGATACT
                  ************************************************************

HsCD00082467      GATTTGGTCCTTGTAATTGGAGCTAATGACACTGTTAATTCAGCAGCTCAAGAAGATCCC
NM_012343.3       GATTTGGTCCTTGTAATTGGAGCTAATGACACTGTTAATTCAGCAGCTCAAGAAGATCCC
NM_182977.2       GATTTGGTCCTTGTAATTGGAGCTAATGACACTGTTAATTCAGCAGCTCAAGAAGATCCC
                  ************************************************************

HsCD00082467      AACTCTATTATTGCAGGCATGCCAGTCCTTGAGGTCTGGAAATCAAAGCAGGTGATTGTT
NM_012343.3       AACTCTATTATTGCAGGCATGCCAGTCCTTGAGGTCTGGAAATCAAAGCAGGTGATTGTT
NM_182977.2       AACTCTATTATTGCAGGCATGCCAGTCCTTGAGGTCTGGAAATCAAAGCAGGTGATTGTT
                  ************************************************************

HsCD00082467      ATGAAGAGGTCTTTGGGTGTTGGCTATGCTGCAGTGGACAATCCAATCTTCTACAGACCT
NM_012343.3       ATGAAGAGGTCTTTGGGTGTTGGCTATGCTGCAGTGGACAATCCAATCTTCTACAAACCT
NM_182977.2       ATGAAGAGGTCTTTGGGTGTTGGCTATGCTGCAGTGGACAATCCAATCTTCTACAAACCT
                  *******************************************************.****

HsCD00082467      AACACGGCCATGCTTCTAGGTGATGCCAAGAAAACATGTGACGCGCTCCAGGCGAAAGTT
NM_012343.3       AACACGGCCATGCTTCTAGGTGATGCCAAGAAAACATGTGACGCGCTCCAGGCGAAAGTT
NM_182977.2       AACACGGCCATGCTTCTAGGTGATGCCAAGAAAACATGTGACGCGCTCCAGGCGAAAGTT
                  ************************************************************

HsCD00082467      AGAGAATCCTATCAGAAG---
NM_012343.3       AGAGAATCCTATCAGAAGTAA
NM_182977.2       AGAGAATCCTATCAGAAGTAA
                  ******************   

Pathways

Reactome : Citric acid cycle (TCA cycle)
Reactome : Metabolism
Reactome : Pyruvate metabolism and Citric Acid (TCA) cycle
Reactome : The citric acid (TCA) cycle and respiratory electron transport

Clone

Cloning Information : 267091
HIP Master Clone ID : 199189
IMAGE ID : 100002300
Original Clone ID : FLH267091.01L

Organism


TAX_ID : 9606
Species Specific ID: 23530

Genome

Chromosome : 5
Map Location : 5p12
Ensembl : ENSG00000112992

Reagents

Labome : NNT-antibody