DNASU Plasmid Repository • 480.965.5697 | Email

CARD15 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NOD2
Gene Name:  nucleotide-binding oligomerization domain containing 2
Sequence             
Original Clone ID: FLH269533.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082759

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3123nts         Open reading frame : 1 to 3123
Reference Sequence Alignment

ATGGGGGAAGAGGGTGGTTCAGCCTCTCACGATGAGGAGGAAAGAGCAAGTGTCCTCCTC
GGACATTCTCCGGGTTGTGAAATGTGCTCGCAGGAGGCTTTTCAGGCACAGAGGAGCCAG
CTGGTCGAGCTGCTGGTCTCAGGGTCCCTGGAAGGCTTCGAGAGTGTCCTGGACTGGCTG
CTGTCCTGGGAGGTCCTCTCCTGGGAGGACTACGAGGGCTTCCACCTCCTGGGCCAGCCT
CTCTCCCACTTGGCCAGGCGCCTTCTGGACACCGTCTGGAATAAGGGTACTTGGGCCTGT
CAGAAGCTCATCGCGGCTGCCCAAGAAGCCCAGGCCGACAGCCAGTCCCCCAAGCTGCAT
GGCTGCTGGGACCCCCACTCGCTCCACCCAGCCCGAGACCTGCAGAGTCACCGGCCAGCC
ATTGTCAGGAGGCTCCACAGCCATGTGGAGAACATGCTGGACCTGGCATGGGAGCGGGGT
TTCGTCAGCCAGTATGAATGTGATGAAATCAGGTTGCCGATCTTCACACCGTCCCAGAGG
GCAAGAAGGCTGCTTGATCTTGCCACGGTGAAAGCGAATGGATTGGCTGCCTTCCTTCTA
CAACATGTTCAGGAATTACCAGTCCCATTGGCCCTGCCTTTGGAAGCTGCCACATGCAAG
AAGTATATGGCCAAGCTGAGGACCACGGTGTCTGCTCAGTCTCGCTTCCTCAGTACCTAT
GATGGAGCAGAGACGCTCTGCCTGGAGGACATATACACAGAGAATGTCCTGGAGGTCTGG
GCAGATGTGGGCATGGCTGGACCCCCGCAGAAGAGCCCAGCCACCCTGGGCCTGGAGGAG
CTCTTCAGCACCCCTGGCCACCTCAATGACGATGCGGACACTGTGCTGGTGGTGGGTGAG
GCGGGCAGTGGCAAGAGCACGCTCCTGCAGCGGCTGCACTTGCTGTGGGCTGCAGGGCAA
GACTTCCAGGAATTTCTCTTTGTCTTCCCATTCAGCTGCCGGCAGCTGCAGTGCATGGCC
AAACCACTCTCTGTGCGGACTCTACTCTTTGAGCACTGCTGTTGGCCTGATGTTGGTCAA
GAAGACATCTTCCAGTTACTCCTTGACCACCCTGACCGTGTCCTGTTAACCTTTGATGGC
TTTGACGAGTTCAAGTTCAGGTTCACGGATCGTGAACGCCACTGCTCCCCGACCGACCCC
ACCTCTGTCCAGACCCTGCTCTTCAACCTTCTGCAGGGCAACCTGCTGAAGAATGCCCGC
AAGGTGGTGACCAGCCGTCCGGCCGCTGTGTCGGCGTTCCTCAGGAAGTACATCCGCACC
GAGTTCAACCTCAAGGGCTTCTCTGAACAGGGCATCGAGCTGTACCTGAGGAAGCGCCAT
CATGAGCCCGGGGTGGCGGACCGCCTCATCCGCCTGCTCCAAGAGACCTCAGCCCTGCAC
GGTTTGTGCCACCTGCCTGTCTTCTCATGGATGGTGTCCAAATGCCACCAGGAACTGTTG
CTGCAGGAGGGGGGGTCCCCAAAGACCACTACAGATATGTACCTGCTGATTCTGCAGCAT
TTTCTGCTGCATGCCACCCCCCCAGACTCAGCTTCCCAAGGTCTGGGACCCAGTCTTCTT
CGGGGCCGCCTCCCCACCCTCCTGCACCTGGGCAGACTGGCTCTGTGGGGCCTGGGCATG
TGCTGCTACGTGTTCTCAGCCCAGCAGCTCCAGGCAGCACAGGTCAGCCCTGATGACATT
TCTCTTGGCTTCCTGGTGCGTGCCAAAGGTGTCGTGCCAGGGAGTACGGCGCCCCTGGAA
TTCCTTCACATCACTTTCCAGTGCTTCTTTGCCGCGTTCTACCTGGCACTCAGTGCTGAT
GTGCCACCAGCTTTGCTCAGACACCTCTTCAATTGTGGCAGGCCAGGCAACTCACCAATG
GCCAGGCTCCTGCCCACGATGTGCATCCAGGCCTCGGAGGGAAAGGACAGCAGCGTGGCA
GCTTTGCTGCAGAAGGCCGAGCCGCACAACCTTCAGATCACAGCAGCCTTCCTGGCAGGG
CTGTTGTCCCGGGAGCACTGGGGCCTGCTGGCTGAGTGCCAGACATCTGAGAAGGCCCTG
CTCCGGCGCCAGGCCTGTGCCCGCTGGTGTCTGGCCCGCAGCCTCCGCAAGCACTTCCAC
TCCATCCCGCCAGCTGCACCGGGTGAGGCCAAGAGCGTGCATGCCATGCCCGGGTTCATC
TGGCTCATCCGGAGCCTGTACGAGATGCAGGAGGAGCGGCTGGCTCGGAAGGCTGCACGT
GGCCTGAATGTTGGGCACCTCAAGTTGACATTTTGCAGTGTGGGCCCCACTGAGTGTGCT
GCCCTGGCCTTTGTGCTGCAGCACCTCCGGCGGCCCGTGGCCCTGCAGCTGGACTACAAC
TCTGTGGGTGACATTGGCGTGGAGCAGCTGCTGCCTTGCCTTGGTGTCTGCAAGGCTCTG
TATTTGCGCGATAACAATATCTCAGACCGAGGCATCTGCAAGCTCATTGAATGTGCTCTT
CACTGCGAGCAATTGCAGAAGTTAGCTCTATTCAACAACAAATTGACTGACGGCTGTGCA
CACTCCATGGCTAAGCTCCTTGCATGCAGGCAGAACTTCTTGGCATTGAGGCTGGGGAAT
AACTACATCACTGCCGCGGGAGCCCAAGTGCTGGCCGAGGGGCTCCGAGGCAACACCTCC
TTGCAGTTCCTGGGATTCTGGGGCAACAGAGTGGGTGACGAGGGGGCCCAGGCCCTGGCT
GAAGCCTTGGGTGATCACCAGAGCTTGAGGTGGCTCAGCCTGGTGGGGAACAACATTGGC
AGTGTGGGTGCCCAAGCCTTGGCACTGATGCTGGCAAAGAACGTCATGCTAGAAGAACTC
TGCCTGGAGGAGAACCATCTCCAGGATGAAGGTGTATGTTCTCTCGCAGAAGGACTGAAG
AAAAATTCAAGTTTGAAAATCCTGAAGTTGTCCAATAACTGCATCACCTACCTAGGGGCA
GAAGCCCTCCTGCAGGCCCTTGAAAGGAATGACACCATCCTGGAAGTCTGGCTCCGAGGG
AACACTTTCTCTCTAGAGGAGGTTGACAAGCTCGGCTGCAGGGACACCAGACTCTTGCTT
TAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3228
Start on reference sequence 106
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NOD2
Symbol Nomenclature : NOD2
SYNONYM : ACUG; BLAU; CARD15; CD; CLR16.3; IBD1; NLRC2; NOD2B; PSORAS1
Designation : NLR family, CARD domain containing 2|NOD-like receptor C2|caspase recruitment domain family, member 15|caspase recruitment domain protein 15|caspase recruitment domain-containing protein 15|inflammatory bowel disease protein 1|nucleotide-binding oligomerization domain 2|nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2|nucleotide-binding oligomerization domain-containing protein 2
Full Nomenclature : nucleotide-binding oligomerization domain containing 2
GENEID : 64127
GI : 162317701
GenBank Accession : BC156571
HGNC : 5331
MIM : 605956
Vega : OTTHUMG00000133171
Target GenBank: NM_022162

 

Reference Sequence Alignment

  

HsCD00082759        ATGGGGGAAGAGGGTGGTTCAGCCTCTCACGATGAGGAGGAAAGAGCAAGTGTCCTCCTC
NM_022162.1         ATGGGGGAAGAGGGTGGTTCAGCCTCTCACGATGAGGAGGAAAGAGCAAGTGTCCTCCTC
XM_005256084.1      ------------------------------------------------------------
                                                                                

HsCD00082759        GGACATTCTCCGGGTTGTGAAATGTGCTCGCAGGAGGCTTTTCAGGCACAGAGGAGCCAG
NM_022162.1         GGACATTCTCCGGGTTGTGAAATGTGCTCGCAGGAGGCTTTTCAGGCACAGAGGAGCCAG
XM_005256084.1      ---------------------ATGTGCTCGCAGGAGGCTTTTCAGGCACAGAGGAGCCAG
                                         ***************************************

HsCD00082759        CTGGTCGAGCTGCTGGTCTCAGGGTCCCTGGAAGGCTTCGAGAGTGTCCTGGACTGGCTG
NM_022162.1         CTGGTCGAGCTGCTGGTCTCAGGGTCCCTGGAAGGCTTCGAGAGTGTCCTGGACTGGCTG
XM_005256084.1      CTGGTCGAGCTGCTGGTCTCAGGGTCCCTGGAAGGCTTCGAGAGTGTCCTGGACTGGCTG
                    ************************************************************

HsCD00082759        CTGTCCTGGGAGGTCCTCTCCTGGGAGGACTACGAGGGCTTCCACCTCCTGGGCCAGCCT
NM_022162.1         CTGTCCTGGGAGGTCCTCTCCTGGGAGGACTACGAGGGCTTCCACCTCCTGGGCCAGCCT
XM_005256084.1      CTGTCCTGGGAGGTCCTCTCCTGGGAGGACTACGAGGGCTTCCACCTCCTGGGCCAGCCT
                    ************************************************************

HsCD00082759        CTCTCCCACTTGGCCAGGCGCCTTCTGGACACCGTCTGGAATAAGGGTACTTGGGCCTGT
NM_022162.1         CTCTCCCACTTGGCCAGGCGCCTTCTGGACACCGTCTGGAATAAGGGTACTTGGGCCTGT
XM_005256084.1      CTCTCCCACTTGGCCAGGCGCCTTCTGGACACCGTCTGGAATAAGGGTACTTGGGCCTGT
                    ************************************************************

HsCD00082759        CAGAAGCTCATCGCGGCTGCCCAAGAAGCCCAGGCCGACAGCCAGTCCCCCAAGCTGCAT
NM_022162.1         CAGAAGCTCATCGCGGCTGCCCAAGAAGCCCAGGCCGACAGCCAGTCCCCCAAGCTGCAT
XM_005256084.1      CAGAAGCTCATCGCGGCTGCCCAAGAAGCCCAGGCCGACAGCCAGTCCCCCAAGCTGCAT
                    ************************************************************

HsCD00082759        GGCTGCTGGGACCCCCACTCGCTCCACCCAGCCCGAGACCTGCAGAGTCACCGGCCAGCC
NM_022162.1         GGCTGCTGGGACCCCCACTCGCTCCACCCAGCCCGAGACCTGCAGAGTCACCGGCCAGCC
XM_005256084.1      GGCTGCTGGGACCCCCACTCGCTCCACCCAGCCCGAGACCTGCAGAGTCACCGGCCAGCC
                    ************************************************************

HsCD00082759        ATTGTCAGGAGGCTCCACAGCCATGTGGAGAACATGCTGGACCTGGCATGGGAGCGGGGT
NM_022162.1         ATTGTCAGGAGGCTCCACAGCCATGTGGAGAACATGCTGGACCTGGCATGGGAGCGGGGT
XM_005256084.1      ATTGTCAGGAGGCTCCACAGCCATGTGGAGAACATGCTGGACCTGGCATGGGAGCGGGGT
                    ************************************************************

HsCD00082759        TTCGTCAGCCAGTATGAATGTGATGAAATCAGGTTGCCGATCTTCACACCGTCCCAGAGG
NM_022162.1         TTCGTCAGCCAGTATGAATGTGATGAAATCAGGTTGCCGATCTTCACACCGTCCCAGAGG
XM_005256084.1      TTCGTCAGCCAGTATGAATGTGATGAAATCAGGTTGCCGATCTTCACACCGTCCCAGAGG
                    ************************************************************

HsCD00082759        GCAAGAAGGCTGCTTGATCTTGCCACGGTGAAAGCGAATGGATTGGCTGCCTTCCTTCTA
NM_022162.1         GCAAGAAGGCTGCTTGATCTTGCCACGGTGAAAGCGAATGGATTGGCTGCCTTCCTTCTA
XM_005256084.1      GCAAGAAGGCTGCTTGATCTTGCCACGGTGAAAGCGAATGGATTGGCTGCCTTCCTTCTA
                    ************************************************************

HsCD00082759        CAACATGTTCAGGAATTACCAGTCCCATTGGCCCTGCCTTTGGAAGCTGCCACATGCAAG
NM_022162.1         CAACATGTTCAGGAATTACCAGTCCCATTGGCCCTGCCTTTGGAAGCTGCCACATGCAAG
XM_005256084.1      CAACATGTTCAGGAATTACCAGTCCCATTGGCCCTGCCTTTGGAAGCTGCCACATGCAAG
                    ************************************************************

HsCD00082759        AAGTATATGGCCAAGCTGAGGACCACGGTGTCTGCTCAGTCTCGCTTCCTCAGTACCTAT
NM_022162.1         AAGTATATGGCCAAGCTGAGGACCACGGTGTCTGCTCAGTCTCGCTTCCTCAGTACCTAT
XM_005256084.1      AAGTATATGGCCAAGCTGAGGACCACGGTGTCTGCTCAGTCTCGCTTCCTCAGTACCTAT
                    ************************************************************

HsCD00082759        GATGGAGCAGAGACGCTCTGCCTGGAGGACATATACACAGAGAATGTCCTGGAGGTCTGG
NM_022162.1         GATGGAGCAGAGACGCTCTGCCTGGAGGACATATACACAGAGAATGTCCTGGAGGTCTGG
XM_005256084.1      GATGGAGCAGAGACGCTCTGCCTGGAGGACATATACACAGAGAATGTCCTGGAGGTCTGG
                    ************************************************************

HsCD00082759        GCAGATGTGGGCATGGCTGGACCCCCGCAGAAGAGCCCAGCCACCCTGGGCCTGGAGGAG
NM_022162.1         GCAGATGTGGGCATGGCTGGACCCCCGCAGAAGAGCCCAGCCACCCTGGGCCTGGAGGAG
XM_005256084.1      GCAGATGTGGGCATGGCTGGACCCCCGCAGAAGAGCCCAGCCACCCTGGGCCTGGAGGAG
                    ************************************************************

HsCD00082759        CTCTTCAGCACCCCTGGCCACCTCAATGACGATGCGGACACTGTGCTGGTGGTGGGTGAG
NM_022162.1         CTCTTCAGCACCCCTGGCCACCTCAATGACGATGCGGACACTGTGCTGGTGGTGGGTGAG
XM_005256084.1      CTCTTCAGCACCCCTGGCCACCTCAATGACGATGCGGACACTGTGCTGGTGGTGGGTGAG
                    ************************************************************

HsCD00082759        GCGGGCAGTGGCAAGAGCACGCTCCTGCAGCGGCTGCACTTGCTGTGGGCTGCAGGGCAA
NM_022162.1         GCGGGCAGTGGCAAGAGCACGCTCCTGCAGCGGCTGCACTTGCTGTGGGCTGCAGGGCAA
XM_005256084.1      GCGGGCAGTGGCAAGAGCACGCTCCTGCAGCGGCTGCACTTGCTGTGGGCTGCAGGGCAA
                    ************************************************************

HsCD00082759        GACTTCCAGGAATTTCTCTTTGTCTTCCCATTCAGCTGCCGGCAGCTGCAGTGCATGGCC
NM_022162.1         GACTTCCAGGAATTTCTCTTTGTCTTCCCATTCAGCTGCCGGCAGCTGCAGTGCATGGCC
XM_005256084.1      GACTTCCAGGAATTTCTCTTTGTCTTCCCATTCAGCTGCCGGCAGCTGCAGTGCATGGCC
                    ************************************************************

HsCD00082759        AAACCACTCTCTGTGCGGACTCTACTCTTTGAGCACTGCTGTTGGCCTGATGTTGGTCAA
NM_022162.1         AAACCACTCTCTGTGCGGACTCTACTCTTTGAGCACTGCTGTTGGCCTGATGTTGGTCAA
XM_005256084.1      AAACCACTCTCTGTGCGGACTCTACTCTTTGAGCACTGCTGTTGGCCTGATGTTGGTCAA
                    ************************************************************

HsCD00082759        GAAGACATCTTCCAGTTACTCCTTGACCACCCTGACCGTGTCCTGTTAACCTTTGATGGC
NM_022162.1         GAAGACATCTTCCAGTTACTCCTTGACCACCCTGACCGTGTCCTGTTAACCTTTGATGGC
XM_005256084.1      GAAGACATCTTCCAGTTACTCCTTGACCACCCTGACCGTGTCCTGTTAACCTTTGATGGC
                    ************************************************************

HsCD00082759        TTTGACGAGTTCAAGTTCAGGTTCACGGATCGTGAACGCCACTGCTCCCCGACCGACCCC
NM_022162.1         TTTGACGAGTTCAAGTTCAGGTTCACGGATCGTGAACGCCACTGCTCCCCGACCGACCCC
XM_005256084.1      TTTGACGAGTTCAAGTTCAGGTTCACGGATCGTGAACGCCACTGCTCCCCGACCGACCCC
                    ************************************************************

HsCD00082759        ACCTCTGTCCAGACCCTGCTCTTCAACCTTCTGCAGGGCAACCTGCTGAAGAATGCCCGC
NM_022162.1         ACCTCTGTCCAGACCCTGCTCTTCAACCTTCTGCAGGGCAACCTGCTGAAGAATGCCCGC
XM_005256084.1      ACCTCTGTCCAGACCCTGCTCTTCAACCTTCTGCAGGGCAACCTGCTGAAGAATGCCCGC
                    ************************************************************

HsCD00082759        AAGGTGGTGACCAGCCGTCCGGCCGCTGTGTCGGCGTTCCTCAGGAAGTACATCCGCACC
NM_022162.1         AAGGTGGTGACCAGCCGTCCGGCCGCTGTGTCGGCGTTCCTCAGGAAGTACATCCGCACC
XM_005256084.1      AAGGTGGTGACCAGCCGTCCGGCCGCTGTGTCGGCGTTCCTCAGGAAGTACATCCGCACC
                    ************************************************************

HsCD00082759        GAGTTCAACCTCAAGGGCTTCTCTGAACAGGGCATCGAGCTGTACCTGAGGAAGCGCCAT
NM_022162.1         GAGTTCAACCTCAAGGGCTTCTCTGAACAGGGCATCGAGCTGTACCTGAGGAAGCGCCAT
XM_005256084.1      GAGTTCAACCTCAAGGGCTTCTCTGAACAGGGCATCGAGCTGTACCTGAGGAAGCGCCAT
                    ************************************************************

HsCD00082759        CATGAGCCCGGGGTGGCGGACCGCCTCATCCGCCTGCTCCAAGAGACCTCAGCCCTGCAC
NM_022162.1         CATGAGCCCGGGGTGGCGGACCGCCTCATCCGCCTGCTCCAAGAGACCTCAGCCCTGCAC
XM_005256084.1      CATGAGCCCGGGGTGGCGGACCGCCTCATCCGCCTGCTCCAAGAGACCTCAGCCCTGCAC
                    ************************************************************

HsCD00082759        GGTTTGTGCCACCTGCCTGTCTTCTCATGGATGGTGTCCAAATGCCACCAGGAACTGTTG
NM_022162.1         GGTTTGTGCCACCTGCCTGTCTTCTCATGGATGGTGTCCAAATGCCACCAGGAACTGTTG
XM_005256084.1      GGTTTGTGCCACCTGCCTGTCTTCTCATGGATGGTGTCCAAATGCCACCAGGAACTGTTG
                    ************************************************************

HsCD00082759        CTGCAGGAGGGGGGGTCCCCAAAGACCACTACAGATATGTACCTGCTGATTCTGCAGCAT
NM_022162.1         CTGCAGGAGGGGGGGTCCCCAAAGACCACTACAGATATGTACCTGCTGATTCTGCAGCAT
XM_005256084.1      CTGCAGGAGGGGGGGTCCCCAAAGACCACTACAGATATGTACCTGCTGATTCTGCAGCAT
                    ************************************************************

HsCD00082759        TTTCTGCTGCATGCCACCCCCCCAGACTCAGCTTCCCAAGGTCTGGGACCCAGTCTTCTT
NM_022162.1         TTTCTGCTGCATGCCACCCCCCCAGACTCAGCTTCCCAAGGTCTGGGACCCAGTCTTCTT
XM_005256084.1      TTTCTGCTGCATGCCACCCCCCCAGACTCAGCTTCCCAAGGTCTGGGACCCAGTCTTCTT
                    ************************************************************

HsCD00082759        CGGGGCCGCCTCCCCACCCTCCTGCACCTGGGCAGACTGGCTCTGTGGGGCCTGGGCATG
NM_022162.1         CGGGGCCGCCTCCCCACCCTCCTGCACCTGGGCAGACTGGCTCTGTGGGGCCTGGGCATG
XM_005256084.1      CGGGGCCGCCTCCCCACCCTCCTGCACCTGGGCAGACTGGCTCTGTGGGGCCTGGGCATG
                    ************************************************************

HsCD00082759        TGCTGCTACGTGTTCTCAGCCCAGCAGCTCCAGGCAGCACAGGTCAGCCCTGATGACATT
NM_022162.1         TGCTGCTACGTGTTCTCAGCCCAGCAGCTCCAGGCAGCACAGGTCAGCCCTGATGACATT
XM_005256084.1      TGCTGCTACGTGTTCTCAGCCCAGCAGCTCCAGGCAGCACAGGTCAGCCCTGATGACATT
                    ************************************************************

HsCD00082759        TCTCTTGGCTTCCTGGTGCGTGCCAAAGGTGTCGTGCCAGGGAGTACGGCGCCCCTGGAA
NM_022162.1         TCTCTTGGCTTCCTGGTGCGTGCCAAAGGTGTCGTGCCAGGGAGTACGGCGCCCCTGGAA
XM_005256084.1      TCTCTTGGCTTCCTGGTGCGTGCCAAAGGTGTCGTGCCAGGGAGTACGGCGCCCCTGGAA
                    ************************************************************

HsCD00082759        TTCCTTCACATCACTTTCCAGTGCTTCTTTGCCGCGTTCTACCTGGCACTCAGTGCTGAT
NM_022162.1         TTCCTTCACATCACTTTCCAGTGCTTCTTTGCCGCGTTCTACCTGGCACTCAGTGCTGAT
XM_005256084.1      TTCCTTCACATCACTTTCCAGTGCTTCTTTGCCGCGTTCTACCTGGCACTCAGTGCTGAT
                    ************************************************************

HsCD00082759        GTGCCACCAGCTTTGCTCAGACACCTCTTCAATTGTGGCAGGCCAGGCAACTCACCAATG
NM_022162.1         GTGCCACCAGCTTTGCTCAGACACCTCTTCAATTGTGGCAGGCCAGGCAACTCACCAATG
XM_005256084.1      GTGCCACCAGCTTTGCTCAGACACCTCTTCAATTGTGGCAGGCCAGGCAACTCACCAATG
                    ************************************************************

HsCD00082759        GCCAGGCTCCTGCCCACGATGTGCATCCAGGCCTCGGAGGGAAAGGACAGCAGCGTGGCA
NM_022162.1         GCCAGGCTCCTGCCCACGATGTGCATCCAGGCCTCGGAGGGAAAGGACAGCAGCGTGGCA
XM_005256084.1      GCCAGGCTCCTGCCCACGATGTGCATCCAGGCCTCGGAGGGAAAGGACAGCAGCGTGGCA
                    ************************************************************

HsCD00082759        GCTTTGCTGCAGAAGGCCGAGCCGCACAACCTTCAGATCACAGCAGCCTTCCTGGCAGGG
NM_022162.1         GCTTTGCTGCAGAAGGCCGAGCCGCACAACCTTCAGATCACAGCAGCCTTCCTGGCAGGG
XM_005256084.1      GCTTTGCTGCAGAAGGCCGAGCCGCACAACCTTCAGATCACAGCAGCCTTCCTGGCAGGG
                    ************************************************************

HsCD00082759        CTGTTGTCCCGGGAGCACTGGGGCCTGCTGGCTGAGTGCCAGACATCTGAGAAGGCCCTG
NM_022162.1         CTGTTGTCCCGGGAGCACTGGGGCCTGCTGGCTGAGTGCCAGACATCTGAGAAGGCCCTG
XM_005256084.1      CTGTTGTCCCGGGAGCACTGGGGCCTGCTGGCTGAGTGCCAGACATCTGAGAAGGCCCTG
                    ************************************************************

HsCD00082759        CTCCGGCGCCAGGCCTGTGCCCGCTGGTGTCTGGCCCGCAGCCTCCGCAAGCACTTCCAC
NM_022162.1         CTCCGGCGCCAGGCCTGTGCCCGCTGGTGTCTGGCCCGCAGCCTCCGCAAGCACTTCCAC
XM_005256084.1      CTCCGGCGCCAGGCCTGTGCCCGCTGGTGTCTGGCCCGCAGCCTCCGCAAGCACTTCCAC
                    ************************************************************

HsCD00082759        TCCATCCCGCCAGCTGCACCGGGTGAGGCCAAGAGCGTGCATGCCATGCCCGGGTTCATC
NM_022162.1         TCCATCCCGCCAGCTGCACCGGGTGAGGCCAAGAGCGTGCATGCCATGCCCGGGTTCATC
XM_005256084.1      TCCATCCCGCCAGCTGCACCGGGTGAGGCCAAGAGCGTGCATGCCATGCCCGGGTTCATC
                    ************************************************************

HsCD00082759        TGGCTCATCCGGAGCCTGTACGAGATGCAGGAGGAGCGGCTGGCTCGGAAGGCTGCACGT
NM_022162.1         TGGCTCATCCGGAGCCTGTACGAGATGCAGGAGGAGCGGCTGGCTCGGAAGGCTGCACGT
XM_005256084.1      TGGCTCATCCGGAGCCTGTACGAGATGCAGGAGGAGCGGCTGGCTCGGAAGGCTGCACGT
                    ************************************************************

HsCD00082759        GGCCTGAATGTTGGGCACCTCAAGTTGACATTTTGCAGTGTGGGCCCCACTGAGTGTGCT
NM_022162.1         GGCCTGAATGTTGGGCACCTCAAGTTGACATTTTGCAGTGTGGGCCCCACTGAGTGTGCT
XM_005256084.1      GGCCTGAATGTTGGGCACCTCAAGTTGACATTTTGCAGTGTGGGCCCCACTGAGTGTGCT
                    ************************************************************

HsCD00082759        GCCCTGGCCTTTGTGCTGCAGCACCTCCGGCGGCCCGTGGCCCTGCAGCTGGACTACAAC
NM_022162.1         GCCCTGGCCTTTGTGCTGCAGCACCTCCGGCGGCCCGTGGCCCTGCAGCTGGACTACAAC
XM_005256084.1      GCCCTGGCCTTTGTGCTGCAGCACCTCCGGCGGCCCGTGGCCCTGCAGCTGGACTACAAC
                    ************************************************************

HsCD00082759        TCTGTGGGTGACATTGGCGTGGAGCAGCTGCTGCCTTGCCTTGGTGTCTGCAAGGCTCTG
NM_022162.1         TCTGTGGGTGACATTGGCGTGGAGCAGCTGCTGCCTTGCCTTGGTGTCTGCAAGGCTCTG
XM_005256084.1      TCTGTGGGTGACATTGGCGTGGAGCAGCTGCTGCCTTGCCTTGGTGTCTGCAAGGCTCTG
                    ************************************************************

HsCD00082759        TATTTGCGCGATAACAATATCTCAGACCGAGGCATCTGCAAGCTCATTGAATGTGCTCTT
NM_022162.1         TATTTGCGCGATAACAATATCTCAGACCGAGGCATCTGCAAGCTCATTGAATGTGCTCTT
XM_005256084.1      TATTTGCGCGATAACAATATCTCAGACCGAGGCATCTGCAAGCTCATTGAATGTGCTCTT
                    ************************************************************

HsCD00082759        CACTGCGAGCAATTGCAGAAGTTAGCTCTATTCAACAACAAATTGACTGACGGCTGTGCA
NM_022162.1         CACTGCGAGCAATTGCAGAAGTTAGCTCTATTCAACAACAAATTGACTGACGGCTGTGCA
XM_005256084.1      CACTGCGAGCAATTGCAGAAGTTAGCTCTATTCAACAACAAATTGACTGACGGCTGTGCA
                    ************************************************************

HsCD00082759        CACTCCATGGCTAAGCTCCTTGCATGCAGGCAGAACTTCTTGGCATTGAGGCTGGGGAAT
NM_022162.1         CACTCCATGGCTAAGCTCCTTGCATGCAGGCAGAACTTCTTGGCATTGAGGCTGGGGAAT
XM_005256084.1      CACTCCATGGCTAAGCTCCTTGCATGCAGGCAGAACTTCTTGGCATTGAGGCTGGGGAAT
                    ************************************************************

HsCD00082759        AACTACATCACTGCCGCGGGAGCCCAAGTGCTGGCCGAGGGGCTCCGAGGCAACACCTCC
NM_022162.1         AACTACATCACTGCCGCGGGAGCCCAAGTGCTGGCCGAGGGGCTCCGAGGCAACACCTCC
XM_005256084.1      AACTACATCACTGCCGCGGGAGCCCAAGTGCTGGCCGAGGGGCTCCGAGGCAACACCTCC
                    ************************************************************

HsCD00082759        TTGCAGTTCCTGGGATTCTGGGGCAACAGAGTGGGTGACGAGGGGGCCCAGGCCCTGGCT
NM_022162.1         TTGCAGTTCCTGGGATTCTGGGGCAACAGAGTGGGTGACGAGGGGGCCCAGGCCCTGGCT
XM_005256084.1      TTGCAGTTCCTGGGATTCTGGGGCAACAGAGTGGGTGACGAGGGGGCCCAGGCCCTGGCT
                    ************************************************************

HsCD00082759        GAAGCCTTGGGTGATCACCAGAGCTTGAGGTGGCTCAGCCTGGTGGGGAACAACATTGGC
NM_022162.1         GAAGCCTTGGGTGATCACCAGAGCTTGAGGTGGCTCAGCCTGGTGGGGAACAACATTGGC
XM_005256084.1      GAAGCCTTGGGTGATCACCAGAGCTTGAGGTGGCTCAGCCTGGTGGGGAACAACATTGGC
                    ************************************************************

HsCD00082759        AGTGTGGGTGCCCAAGCCTTGGCACTGATGCTGGCAAAGAACGTCATGCTAGAAGAACTC
NM_022162.1         AGTGTGGGTGCCCAAGCCTTGGCACTGATGCTGGCAAAGAACGTCATGCTAGAAGAACTC
XM_005256084.1      AGTGTGGGTGCCCAAGCCTTGGCACTGATGCTGGCAAAGAACGTCATGCTAGAAGAACTC
                    ************************************************************

HsCD00082759        TGCCTGGAGGAGAACCATCTCCAGGATGAAGGTGTATGTTCTCTCGCAGAAGGACTGAAG
NM_022162.1         TGCCTGGAGGAGAACCATCTCCAGGATGAAGGTGTATGTTCTCTCGCAGAAGGACTGAAG
XM_005256084.1      TGCCTGGAGGAGAACCATCTCCAGGATGAAGGTGTATGTTCTCTCGCAGAAGGACTGAAG
                    ************************************************************

HsCD00082759        AAAAATTCAAGTTTGAAAATCCTGAAGTTGTCCAATAACTGCATCACCTACCTAGGGGCA
NM_022162.1         AAAAATTCAAGTTTGAAAATCCTGAAGTTGTCCAATAACTGCATCACCTACCTAGGGGCA
XM_005256084.1      AAAAATTCAAGTTTGAAAATCCTGAAGTTGTCCAATAACTGCATCACCTACCTAGGGGCA
                    ************************************************************

HsCD00082759        GAAGCCCTCCTGCAGGCCCTTGAAAGGAATGACACCATCCTGGAAGTCTGGCTCCGAGGG
NM_022162.1         GAAGCCCTCCTGCAGGCCCTTGAAAGGAATGACACCATCCTGGAAGTCTGGCTCCGAGGG
XM_005256084.1      GAAGCCCTCCTGCAGGCCCTTGAAAGGAATGACACCATCCTGGAAGTCTGGCTCCGAGGG
                    ************************************************************

HsCD00082759        AACACTTTCTCTCTAGAGGAGGTTGACAAGCTCGGCTGCAGGGACACCAGACTCTTGCTT
NM_022162.1         AACACTTTCTCTCTAGAGGAGGTTGACAAGCTCGGCTGCAGGGACACCAGACTCTTGCTT
XM_005256084.1      AACACTTTCTCTCTAGAGGAGGTTGACAAGCTCGGCTGCAGGGACACCAGACTCTTGCTT
                    ************************************************************

HsCD00082759        TAA
NM_022162.1         TGA
XM_005256084.1      TGA
                    *.*

Pathways

NCI : Canonical NF-kappaB pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : NOD pathway

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
UniProt : Q9HC29
HPRD : 05810

Clone

Cloning Information : 269533
HIP Master Clone ID : 201035
IMAGE ID : 100062065
Original Clone ID : FLH269533.01X

Organism


TAX_ID : 9606
Species Specific ID: 64127

Genome

Chromosome : 16
Map Location : 16q21
Ensembl : ENSG00000167207

Reagents

Labome : NOD2-antibody