DNASU Plasmid Repository • 480.965.5697 | Email

NALP14 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NLRP14
Gene Name:  NLR family, pyrin domain containing 14
Sequence             
Original Clone ID: FLH269646.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082865

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3279nts         Open reading frame : 1 to 3279
Reference Sequence Alignment

ATGGCAGATTCATCATCATCTTCTTTCTTTCCTGATTTTGGGCTGCTATTGTATTTGGAG
GAGCTAAACAAAGAGGAATTAAATACATTCAAGTTATTCCTAAAGGAGACCATGGAACCT
GAGCATGGCCTGACACCCTGGAATGAAGTGAAGAAGGCCAGGCGGGAGGACCTGGCCAAT
TTGATGAAGAAATATTATCCAGGAGAGAAAGCCTGGAGTGTGTCTCTCAAAATCTTTGGC
AAGATGAACCTGAAGGATCTGTGTGAGAGAGCGAAAGAAGAGATCAACTGGTCGGCCCAG
ACTATAGGACCAGATGATGCCAAGGCTGGAGAGACACAAGAAGATCAGGAGGCAGTGCTG
GGTGATGGAACAGAATACAGAAATAGAATAAAGGAAAAATTTTGCATCACTTGGGACAAG
AAGTCTTTGGCTGGAAAGCCTGAAGATTTCCATCATGGAATTGCAGAGAAAGATAGAAAA
CTGTTGGAACACTTGTTCGATGTGGATGTCAAAACCGGTGCACAGCCACAGATCGTGGTG
CTTCAGGGAGCTGCTGGAGTTGGGAAAACAACCTTGGTGAGAAAGGCAATGTTAGATTGG
GCAGAGGGCAGTCTCTACCAGCAGAGGTTTAAGTATGTTTTTTATCTCAATGGGAGAGAA
ATTAACCAGCTGAAAGAGAGAAGCTTTGCTCAATTGATATCAAAGGACTGGCCCAGCACA
GAAGGCCCCATTGAAGAAATCATGTACCAGCCAAGTAGCCTCTTGTTTATTATTGACAGT
TTCGATGAACTGAACTTTGCCTTTGAAGAACCTGAGTTTGCACTGTGCGAAGACTGGACC
CAAGAACACCCAGTGTCCTTCCTCATGAGTAGTTTGCTGAGGAAAGTGATGCTCCCTGAG
GCATCCTTATTGGTGACAACAAGACTCACAACTTCTAAGAGACTAAAGCAGTTGTTGAAG
AATCACCATTATGTAGAGCTACTAGGAATGTCTGAGGATGCAAGAGAGGAGTATATTTAC
CAGTTTTTTGAAGATAAGAGGTGGGCCATGAAAGTATTCAGTTCACTAAAAAGCAATGAG
ATGCTGTTTAGCATGTGCCAAGTCCCCCTAGTGTGCTGGGCCGCTTGTACTTGTCTGAAG
CAGCAAATGGAGAAGGGTGGTGATGTCACATTGACCTGCCAAACAACCACAGCTCTGTTT
ACCTGCTATATTTCTAGCTTGTTCACACCAGTAGATGGAGGCTCTCCTAGTCTACCCAAC
CAAGCCCAGCTGAGAAGACTGTGCCAAGTCGCTGCCAAAGGAATATGGACTATGACTTAC
GTGTTTTACAGAGAAAATCTCAGAAGGCTTGGGTTAACTCAATCTGATGTCTCTAGTTTT
ATGGACAGCAATATTATTCAGAAGGACGCAGAGTATGAAAACTGCTATGTGTTCACCCAC
CTTCATGTTCAGGAGTTTTTTGCAGCTATGTTCTATATGTTGAAAGGCAGTTGGGAAGCT
GGGAACCCTTCCTGCCAGCCTTTTGAAGATTTGAAGTCATTACTTCAAAGCACAAGTTAT
AAAGACCCCCATTTGACACAGATGAAGTGCTTTTTGTTTGGCCTTTTGAATGAAGATCGA
GTAAAACAACTGGAGAGGACTTTTAACTGTAAAATGTCACTGAAGATAAAATCAAAGTTA
CTTCAGTGTATGGAAGTATTAGGAAACAGTGACTATTCTCCATCACAGCTGGGATTTCTG
GAGTTGTTTCACTGTCTGTATGAGACTCAAGATAAAGCGTTTATAAGCCAGGCAATGAGA
TGTTTCCCAAAGGTTGCCATTAATATTTGTGAGAAAATACATTTGCTTGTATCTTCTTTC
TGCCTTAAGCACTGCCGGTGTTTGCGGACCATCAGGCTGTCTGTAACTGTGGTATTTGAG
AAGAAGATATTAAAAACAAGCCTCCCAACTAACACTTGGGATGGTGATCGCATTACTCAC
TGTTGGCAAGATCTCTGTTCTGTGCTTCATACAAATGAACACTTGAGAGAATTGGACCTG
TACCATAGCAACCTTGATAAATCAGCAATGAATATCCTGCATCATGAACTAAGGCACCCA
AACTGTAAACTACAAAAGCTACTGTTGAAATTTATCACTTTCCCTGATGGTTGTCAGGAT
ATCTCTACTTCTTTGATTCATAACAAGAATCTGATGCATCTTGACCTAAAAGGGAGTGAT
ATAGGGGATAATGGAGTAAAGTCATTGTGTGAGGCCTTGAAACACCCAGAGTGTAAACTA
CAGACTCTCAGGCTGGAATCTTGCAACCTAACTGTATTTTGTTGTCTAAATATATCTAAT
GCTCTCATCAGAAGCCAGAGCCTGATATTTCTGAATCTGTCAACCAATAATCTGTTGGAT
GATGGAGTGCAGCTTTTGTGTGAGGCCTTAAGACATCCAAAGTGTTATCTAGAGAGACTG
TCCTTAGAAAGCTGTGGTCTCACAGAGGCTGGCTGTGAGTATCTTTCTTTGGCTCTCATC
AGCAATAAAAGACTGACACATTTGTGCTTGGCAGACAATGTCTTGGGTGATGGTGGAGTA
AAGCTTATGAGTGATGCCCTGCAACATGCACAATGTACTCTGAAGAGCCTTGTGCTGAGG
CGTTGCCATTTCACTTCACTTAGCAGTGAATATCTGTCAACTTCTCTTCTACACAACAAG
AGCCTGACGCATCTGGATCTAGGATCAAACTGGCTACAAGACAATGGAGTGAAGCTTCTG
TGTGATGTCTTTCGGCATCCAAGCTGTAATCTTCAGGACTTGGAATTGATGGGCTGTGTT
CTCACTAATGCATGTTGTCTGGATCTGGCTTCTGTTATTTTGAATAACCCAAACCTGAGG
AGCCTGGACCTTGGGAACAACGATTTGCAGGATGATGGAGTGAAAATTCTGTGTGATGCT
TTGAGATATCCAAACTGTAACATTCAGAGGCTCGGGTTGGAATACTGTGGTTTGACATCT
CTCTGCTGTCAAGATCTCTCCTCTGCTCTTATCTGCAACAAAAGACTGATAAAAATGAAT
CTGACACAGAATACCTTAGGATATGAAGGAATTGTGAAGTTATATAAAGTCTTGAAGTCT
CCTAAGTGTAAACTACAAGTTCTAGGGTTGTGCAAAGAGGCATTTGATGAGGAAGCCCAG
AAGCTGCTGGAAGCTGTGGGAGTTAGCAATCCACACTTAATCATTAAGCCAGATTGTAAC
TATCATAATGAAGAAGATGTGTCTTGGTGGTGGTGTTTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3605
Start on reference sequence 324
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NLRP14
Symbol Nomenclature : NLRP14
SYNONYM : CLR11.2; GC-LRR; NALP14; NOD5; PAN8
Designation : NACHT, LRR and PYD containing protein 14|NACHT, LRR and PYD domains-containing protein 14|NACHT, leucine rich repeat and PYD containing 14|nucleotide-binding oligomerization domain protein 5|nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14
Full Nomenclature : NLR family, pyrin domain containing 14
GENEID : 338323
GI : 162318953
GenBank Accession : BC156268
HGNC : 22939
MIM : 609665
Vega : OTTHUMG00000165508
Target GenBank: NM_176822

 

Reference Sequence Alignment

  

HsCD00082865      ATGGCAGATTCATCATCATCTTCTTTCTTTCCTGATTTTGGGCTGCTATTGTATTTGGAG
NM_176822.3       ATGGCAGATTCATCATCATCTTCTTTCTTTCCTGATTTTGGGCTGCTATTGTATTTGGAG
                  ************************************************************

HsCD00082865      GAGCTAAACAAAGAGGAATTAAATACATTCAAGTTATTCCTAAAGGAGACCATGGAACCT
NM_176822.3       GAGCTAAACAAAGAGGAATTAAATACATTCAAGTTATTCCTAAAGGAGACCATGGAACCT
                  ************************************************************

HsCD00082865      GAGCATGGCCTGACACCCTGGAATGAAGTGAAGAAGGCCAGGCGGGAGGACCTGGCCAAT
NM_176822.3       GAGCATGGCCTGACACCCTGGAATGAAGTGAAGAAGGCCAGGCGGGAGGACCTGGCCAAT
                  ************************************************************

HsCD00082865      TTGATGAAGAAATATTATCCAGGAGAGAAAGCCTGGAGTGTGTCTCTCAAAATCTTTGGC
NM_176822.3       TTGATGAAGAAATATTATCCAGGAGAGAAAGCCTGGAGTGTGTCTCTCAAAATCTTTGGC
                  ************************************************************

HsCD00082865      AAGATGAACCTGAAGGATCTGTGTGAGAGAGCGAAAGAAGAGATCAACTGGTCGGCCCAG
NM_176822.3       AAGATGAACCTGAAGGATCTGTGTGAGAGAGCGAAAGAAGAGATCAACTGGTCGGCCCAG
                  ************************************************************

HsCD00082865      ACTATAGGACCAGATGATGCCAAGGCTGGAGAGACACAAGAAGATCAGGAGGCAGTGCTG
NM_176822.3       ACTATAGGACCAGATGATGCCAAGGCTGGAGAGACACAAGAAGATCAGGAGGCAGTGCTG
                  ************************************************************

HsCD00082865      GGTGATGGAACAGAATACAGAAATAGAATAAAGGAAAAATTTTGCATCACTTGGGACAAG
NM_176822.3       GGTGATGGAACAGAATACAGAAATAGAATAAAGGAAAAATTTTGCATCACTTGGGACAAG
                  ************************************************************

HsCD00082865      AAGTCTTTGGCTGGAAAGCCTGAAGATTTCCATCATGGAATTGCAGAGAAAGATAGAAAA
NM_176822.3       AAGTCTTTGGCTGGAAAGCCTGAAGATTTCCATCATGGAATTGCAGAGAAAGATAGAAAA
                  ************************************************************

HsCD00082865      CTGTTGGAACACTTGTTCGATGTGGATGTCAAAACCGGTGCACAGCCACAGATCGTGGTG
NM_176822.3       CTGTTGGAACACTTGTTCGATGTGGATGTCAAAACCGGTGCACAGCCACAGATCGTGGTG
                  ************************************************************

HsCD00082865      CTTCAGGGAGCTGCTGGAGTTGGGAAAACAACCTTGGTGAGAAAGGCAATGTTAGATTGG
NM_176822.3       CTTCAGGGAGCTGCTGGAGTTGGGAAAACAACCTTGGTGAGAAAGGCAATGTTAGATTGG
                  ************************************************************

HsCD00082865      GCAGAGGGCAGTCTCTACCAGCAGAGGTTTAAGTATGTTTTTTATCTCAATGGGAGAGAA
NM_176822.3       GCAGAGGGCAGTCTCTACCAGCAGAGGTTTAAGTATGTTTTTTATCTCAATGGGAGAGAA
                  ************************************************************

HsCD00082865      ATTAACCAGCTGAAAGAGAGAAGCTTTGCTCAATTGATATCAAAGGACTGGCCCAGCACA
NM_176822.3       ATTAACCAGCTGAAAGAGAGAAGCTTTGCTCAATTGATATCAAAGGACTGGCCCAGCACA
                  ************************************************************

HsCD00082865      GAAGGCCCCATTGAAGAAATCATGTACCAGCCAAGTAGCCTCTTGTTTATTATTGACAGT
NM_176822.3       GAAGGCCCCATTGAAGAAATCATGTACCAGCCAAGTAGCCTCTTGTTTATTATTGACAGT
                  ************************************************************

HsCD00082865      TTCGATGAACTGAACTTTGCCTTTGAAGAACCTGAGTTTGCACTGTGCGAAGACTGGACC
NM_176822.3       TTCGATGAACTGAACTTTGCCTTTGAAGAACCTGAGTTTGCACTGTGCGAAGACTGGACC
                  ************************************************************

HsCD00082865      CAAGAACACCCAGTGTCCTTCCTCATGAGTAGTTTGCTGAGGAAAGTGATGCTCCCTGAG
NM_176822.3       CAAGAACACCCAGTGTCCTTCCTCATGAGTAGTTTGCTGAGGAAAGTGATGCTCCCTGAG
                  ************************************************************

HsCD00082865      GCATCCTTATTGGTGACAACAAGACTCACAACTTCTAAGAGACTAAAGCAGTTGTTGAAG
NM_176822.3       GCATCCTTATTGGTGACAACAAGACTCACAACTTCTAAGAGACTAAAGCAGTTGTTGAAG
                  ************************************************************

HsCD00082865      AATCACCATTATGTAGAGCTACTAGGAATGTCTGAGGATGCAAGAGAGGAGTATATTTAC
NM_176822.3       AATCACCATTATGTAGAGCTACTAGGAATGTCTGAGGATGCAAGAGAGGAGTATATTTAC
                  ************************************************************

HsCD00082865      CAGTTTTTTGAAGATAAGAGGTGGGCCATGAAAGTATTCAGTTCACTAAAAAGCAATGAG
NM_176822.3       CAGTTTTTTGAAGATAAGAGGTGGGCCATGAAAGTATTCAGTTCACTAAAAAGCAATGAG
                  ************************************************************

HsCD00082865      ATGCTGTTTAGCATGTGCCAAGTCCCCCTAGTGTGCTGGGCCGCTTGTACTTGTCTGAAG
NM_176822.3       ATGCTGTTTAGCATGTGCCAAGTCCCCCTAGTGTGCTGGGCCGCTTGTACTTGTCTGAAG
                  ************************************************************

HsCD00082865      CAGCAAATGGAGAAGGGTGGTGATGTCACATTGACCTGCCAAACAACCACAGCTCTGTTT
NM_176822.3       CAGCAAATGGAGAAGGGTGGTGATGTCACATTGACCTGCCAAACAACCACAGCTCTGTTT
                  ************************************************************

HsCD00082865      ACCTGCTATATTTCTAGCTTGTTCACACCAGTAGATGGAGGCTCTCCTAGTCTACCCAAC
NM_176822.3       ACCTGCTATATTTCTAGCTTGTTCACACCAGTAGATGGAGGCTCTCCTAGTCTACCCAAC
                  ************************************************************

HsCD00082865      CAAGCCCAGCTGAGAAGACTGTGCCAAGTCGCTGCCAAAGGAATATGGACTATGACTTAC
NM_176822.3       CAAGCCCAGCTGAGAAGACTGTGCCAAGTCGCTGCCAAAGGAATATGGACTATGACTTAC
                  ************************************************************

HsCD00082865      GTGTTTTACAGAGAAAATCTCAGAAGGCTTGGGTTAACTCAATCTGATGTCTCTAGTTTT
NM_176822.3       GTGTTTTACAGAGAAAATCTCAGAAGGCTTGGGTTAACTCAATCTGATGTCTCTAGTTTT
                  ************************************************************

HsCD00082865      ATGGACAGCAATATTATTCAGAAGGACGCAGAGTATGAAAACTGCTATGTGTTCACCCAC
NM_176822.3       ATGGACAGCAATATTATTCAGAAGGACGCAGAGTATGAAAACTGCTATGTGTTCACCCAC
                  ************************************************************

HsCD00082865      CTTCATGTTCAGGAGTTTTTTGCAGCTATGTTCTATATGTTGAAAGGCAGTTGGGAAGCT
NM_176822.3       CTTCATGTTCAGGAGTTTTTTGCAGCTATGTTCTATATGTTGAAAGGCAGTTGGGAAGCT
                  ************************************************************

HsCD00082865      GGGAACCCTTCCTGCCAGCCTTTTGAAGATTTGAAGTCATTACTTCAAAGCACAAGTTAT
NM_176822.3       GGGAACCCTTCCTGCCAGCCTTTTGAAGATTTGAAGTCATTACTTCAAAGCACAAGTTAT
                  ************************************************************

HsCD00082865      AAAGACCCCCATTTGACACAGATGAAGTGCTTTTTGTTTGGCCTTTTGAATGAAGATCGA
NM_176822.3       AAAGACCCCCATTTGACACAGATGAAGTGCTTTTTGTTTGGCCTTTTGAATGAAGATCGA
                  ************************************************************

HsCD00082865      GTAAAACAACTGGAGAGGACTTTTAACTGTAAAATGTCACTGAAGATAAAATCAAAGTTA
NM_176822.3       GTAAAACAACTGGAGAGGACTTTTAACTGTAAAATGTCACTGAAGATAAAATCAAAGTTA
                  ************************************************************

HsCD00082865      CTTCAGTGTATGGAAGTATTAGGAAACAGTGACTATTCTCCATCACAGCTGGGATTTCTG
NM_176822.3       CTTCAGTGTATGGAAGTATTAGGAAACAGTGACTATTCTCCATCACAGCTGGGATTTCTG
                  ************************************************************

HsCD00082865      GAGTTGTTTCACTGTCTGTATGAGACTCAAGATAAAGCGTTTATAAGCCAGGCAATGAGA
NM_176822.3       GAGTTGTTTCACTGTCTGTATGAGACTCAAGATAAAGCGTTTATAAGCCAGGCAATGAGA
                  ************************************************************

HsCD00082865      TGTTTCCCAAAGGTTGCCATTAATATTTGTGAGAAAATACATTTGCTTGTATCTTCTTTC
NM_176822.3       TGTTTCCCAAAGGTTGCCATTAATATTTGTGAGAAAATACATTTGCTTGTATCTTCTTTC
                  ************************************************************

HsCD00082865      TGCCTTAAGCACTGCCGGTGTTTGCGGACCATCAGGCTGTCTGTAACTGTGGTATTTGAG
NM_176822.3       TGCCTTAAGCACTGCCGGTGTTTGCGGACCATCAGGCTGTCTGTAACTGTGGTATTTGAG
                  ************************************************************

HsCD00082865      AAGAAGATATTAAAAACAAGCCTCCCAACTAACACTTGGGATGGTGATCGCATTACTCAC
NM_176822.3       AAGAAGATATTAAAAACAAGCCTCCCAACTAACACTTGGGATGGTGATCGCATTACTCAC
                  ************************************************************

HsCD00082865      TGTTGGCAAGATCTCTGTTCTGTGCTTCATACAAATGAACACTTGAGAGAATTGGACCTG
NM_176822.3       TGTTGGCAAGATCTCTGTTCTGTGCTTCATACAAATGAACACTTGAGAGAATTGGACCTG
                  ************************************************************

HsCD00082865      TACCATAGCAACCTTGATAAATCAGCAATGAATATCCTGCATCATGAACTAAGGCACCCA
NM_176822.3       TACCATAGCAACCTTGATAAATCAGCAATGAATATCCTGCATCATGAACTAAGGCACCCA
                  ************************************************************

HsCD00082865      AACTGTAAACTACAAAAGCTACTGTTGAAATTTATCACTTTCCCTGATGGTTGTCAGGAT
NM_176822.3       AACTGTAAACTACAAAAGCTACTGTTGAAATTTATCACTTTCCCTGATGGTTGTCAGGAT
                  ************************************************************

HsCD00082865      ATCTCTACTTCTTTGATTCATAACAAGAATCTGATGCATCTTGACCTAAAAGGGAGTGAT
NM_176822.3       ATCTCTACTTCTTTGATTCATAACAAGAATCTGATGCATCTTGACCTAAAAGGGAGTGAT
                  ************************************************************

HsCD00082865      ATAGGGGATAATGGAGTAAAGTCATTGTGTGAGGCCTTGAAACACCCAGAGTGTAAACTA
NM_176822.3       ATAGGGGATAATGGAGTAAAGTCATTGTGTGAGGCCTTGAAACACCCAGAGTGTAAACTA
                  ************************************************************

HsCD00082865      CAGACTCTCAGGCTGGAATCTTGCAACCTAACTGTATTTTGTTGTCTAAATATATCTAAT
NM_176822.3       CAGACTCTCAGGCTGGAATCTTGCAACCTAACTGTATTTTGTTGTCTAAATATATCTAAT
                  ************************************************************

HsCD00082865      GCTCTCATCAGAAGCCAGAGCCTGATATTTCTGAATCTGTCAACCAATAATCTGTTGGAT
NM_176822.3       GCTCTCATCAGAAGCCAGAGCCTGATATTTCTGAATCTGTCAACCAATAATCTGTTGGAT
                  ************************************************************

HsCD00082865      GATGGAGTGCAGCTTTTGTGTGAGGCCTTAAGACATCCAAAGTGTTATCTAGAGAGACTG
NM_176822.3       GATGGAGTGCAGCTTTTGTGTGAGGCCTTAAGACATCCAAAGTGTTATCTAGAGAGACTG
                  ************************************************************

HsCD00082865      TCCTTAGAAAGCTGTGGTCTCACAGAGGCTGGCTGTGAGTATCTTTCTTTGGCTCTCATC
NM_176822.3       TCCTTAGAAAGCTGTGGTCTCACAGAGGCTGGCTGTGAGTATCTTTCTTTGGCTCTCATC
                  ************************************************************

HsCD00082865      AGCAATAAAAGACTGACACATTTGTGCTTGGCAGACAATGTCTTGGGTGATGGTGGAGTA
NM_176822.3       AGCAATAAAAGACTGACACATTTGTGCTTGGCAGACAATGTCTTGGGTGATGGTGGAGTA
                  ************************************************************

HsCD00082865      AAGCTTATGAGTGATGCCCTGCAACATGCACAATGTACTCTGAAGAGCCTTGTGCTGAGG
NM_176822.3       AAGCTTATGAGTGATGCCCTGCAACATGCACAATGTACTCTGAAGAGCCTTGTGCTGAGG
                  ************************************************************

HsCD00082865      CGTTGCCATTTCACTTCACTTAGCAGTGAATATCTGTCAACTTCTCTTCTACACAACAAG
NM_176822.3       CGTTGCCATTTCACTTCACTTAGCAGTGAATATCTGTCAACTTCTCTTCTACACAACAAG
                  ************************************************************

HsCD00082865      AGCCTGACGCATCTGGATCTAGGATCAAACTGGCTACAAGACAATGGAGTGAAGCTTCTG
NM_176822.3       AGCCTGACGCATCTGGATCTAGGATCAAACTGGCTACAAGACAATGGAGTGAAGCTTCTG
                  ************************************************************

HsCD00082865      TGTGATGTCTTTCGGCATCCAAGCTGTAATCTTCAGGACTTGGAATTGATGGGCTGTGTT
NM_176822.3       TGTGATGTCTTTCGGCATCCAAGCTGTAATCTTCAGGACTTGGAATTGATGGGCTGTGTT
                  ************************************************************

HsCD00082865      CTCACTAATGCATGTTGTCTGGATCTGGCTTCTGTTATTTTGAATAACCCAAACCTGAGG
NM_176822.3       CTCACTAATGCATGTTGTCTGGATCTGGCTTCTGTTATTTTGAATAACCCAAACCTGAGG
                  ************************************************************

HsCD00082865      AGCCTGGACCTTGGGAACAACGATTTGCAGGATGATGGAGTGAAAATTCTGTGTGATGCT
NM_176822.3       AGCCTGGACCTTGGGAACAACGATTTGCAGGATGATGGAGTGAAAATTCTGTGTGATGCT
                  ************************************************************

HsCD00082865      TTGAGATATCCAAACTGTAACATTCAGAGGCTCGGGTTGGAATACTGTGGTTTGACATCT
NM_176822.3       TTGAGATATCCAAACTGTAACATTCAGAGGCTCGGGTTGGAATACTGTGGTTTGACATCT
                  ************************************************************

HsCD00082865      CTCTGCTGTCAAGATCTCTCCTCTGCTCTTATCTGCAACAAAAGACTGATAAAAATGAAT
NM_176822.3       CTCTGCTGTCAAGATCTCTCCTCTGCTCTTATCTGCAACAAAAGACTGATAAAAATGAAT
                  ************************************************************

HsCD00082865      CTGACACAGAATACCTTAGGATATGAAGGAATTGTGAAGTTATATAAAGTCTTGAAGTCT
NM_176822.3       CTGACACAGAATACCTTAGGATATGAAGGAATTGTGAAGTTATATAAAGTCTTGAAGTCT
                  ************************************************************

HsCD00082865      CCTAAGTGTAAACTACAAGTTCTAGGGTTGTGCAAAGAGGCATTTGATGAGGAAGCCCAG
NM_176822.3       CCTAAGTGTAAACTACAAGTTCTAGGGTTGTGCAAAGAGGCATTTGATGAGGAAGCCCAG
                  ************************************************************

HsCD00082865      AAGCTGCTGGAAGCTGTGGGAGTTAGCAATCCACACTTAATCATTAAGCCAGATTGTAAC
NM_176822.3       AAGCTGCTGGAAGCTGTGGGAGTTAGCAATCCACACTTAATCATTAAGCCAGATTGTAAC
                  ************************************************************

HsCD00082865      TATCATAATGAAGAAGATGTGTCTTGGTGGTGGTGTTTC---
NM_176822.3       TATCATAATGAAGAAGATGTGTCTTGGTGGTGGTGTTTCTGA
                  ***************************************   

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
UniProt : Q86W24
HPRD : 11383

Clone

Cloning Information : 269646
HIP Master Clone ID : 201148
IMAGE ID : 100061659
Original Clone ID : FLH269646.01L

Organism


TAX_ID : 9606
Species Specific ID: 338323

Genome

Chromosome : 11
Map Location : 11p15.4
Ensembl : ENSG00000158077

Reagents

Labome : NLRP14-antibody